Incidental Mutation 'R0152:Kbtbd11'
ID22784
Institutional Source Beutler Lab
Gene Symbol Kbtbd11
Ensembl Gene ENSMUSG00000055675
Gene Namekelch repeat and BTB (POZ) domain containing 11
Synonyms4930465M17Rik, 2900016B01Rik
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0152 (G1)
Quality Score193
Status Validated (trace)
Chromosome8
Chromosomal Location15011025-15033333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15027428 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000139292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069399] [ENSMUST00000183471]
Predicted Effect probably damaging
Transcript: ENSMUST00000069399
AA Change: V9A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068321
Gene: ENSMUSG00000055675
AA Change: V9A

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183471
AA Change: V9A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139292
Gene: ENSMUSG00000055675
AA Change: V9A

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192473
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Kbtbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Kbtbd11 APN 8 15029176 missense probably damaging 1.00
IGL02160:Kbtbd11 APN 8 15028801 missense probably damaging 1.00
IGL02538:Kbtbd11 APN 8 15028841 missense probably damaging 1.00
IGL03039:Kbtbd11 APN 8 15027467 missense probably benign 0.00
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0453:Kbtbd11 UTSW 8 15027499 missense probably benign 0.01
R0498:Kbtbd11 UTSW 8 15027605 missense probably benign
R0629:Kbtbd11 UTSW 8 15027572 missense probably benign
R2031:Kbtbd11 UTSW 8 15028021 missense possibly damaging 0.87
R2214:Kbtbd11 UTSW 8 15029178 missense possibly damaging 0.85
R3720:Kbtbd11 UTSW 8 15029118 nonsense probably null
R3722:Kbtbd11 UTSW 8 15029118 nonsense probably null
R4355:Kbtbd11 UTSW 8 15028578 missense probably damaging 1.00
R4658:Kbtbd11 UTSW 8 15028917 missense possibly damaging 0.59
R5037:Kbtbd11 UTSW 8 15027886 missense probably benign 0.25
R5312:Kbtbd11 UTSW 8 15028589 missense possibly damaging 0.92
R5936:Kbtbd11 UTSW 8 15027534 missense probably benign 0.00
R6056:Kbtbd11 UTSW 8 15027577 missense probably benign
R6272:Kbtbd11 UTSW 8 15029118 nonsense probably null
R6547:Kbtbd11 UTSW 8 15027641 missense possibly damaging 0.83
R7126:Kbtbd11 UTSW 8 15028759 missense probably damaging 1.00
R7359:Kbtbd11 UTSW 8 15028858 missense probably damaging 1.00
R8350:Kbtbd11 UTSW 8 15028603 missense probably damaging 1.00
R8450:Kbtbd11 UTSW 8 15028603 missense probably damaging 1.00
Z1088:Kbtbd11 UTSW 8 15027839 missense probably damaging 1.00
Z1177:Kbtbd11 UTSW 8 15027694 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTGGGCGAGTCCTCCTCACAAG -3'
(R):5'- TCGATGACCAGGTCGGGTTCTC -3'

Sequencing Primer
(F):5'- TCCTCACAAGAGAGGAGAGTG -3'
(R):5'- GCTGCTGACATCCCACTG -3'
Posted On2013-04-16