Incidental Mutation 'R2129:Ulk4'
ID227851
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission 040132-MU
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R2129 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121152182 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 897 (I897F)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect probably benign
Transcript: ENSMUST00000051479
AA Change: I897F

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: I897F

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171923
AA Change: I897F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: I897F

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abhd14a A T 9: 106,440,865 L125Q probably null Het
Abhd17b T A 19: 21,681,049 probably null Het
Abo G A 2: 26,846,574 T61I probably benign Het
Adamts15 T C 9: 30,904,503 T686A probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Anxa2 A T 9: 69,476,128 Y75F possibly damaging Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Aspm T C 1: 139,457,635 V339A probably benign Het
BC055324 T C 1: 163,966,457 Y518C probably damaging Het
Bri3bp T A 5: 125,451,671 L48* probably null Het
Car7 T A 8: 104,548,973 C185S possibly damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chst10 A G 1: 38,865,695 Y203H probably benign Het
Clca1 T C 3: 145,016,765 D282G probably damaging Het
Coq3 T G 4: 21,900,342 S190A probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Cygb A G 11: 116,649,842 L106P probably damaging Het
Dab2 G T 15: 6,336,383 E87* probably null Het
Dcst1 T A 3: 89,357,545 I299F probably damaging Het
Dennd4a T G 9: 64,905,974 probably null Het
Depdc7 A G 2: 104,728,173 S168P probably benign Het
Dicer1 G A 12: 104,722,031 T429I probably damaging Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Dock2 T C 11: 34,727,415 M125V probably damaging Het
Dync2h1 A G 9: 7,175,289 S107P possibly damaging Het
Emb T C 13: 117,267,546 V278A probably damaging Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Galm T C 17: 80,183,218 I268T probably benign Het
Gm5581 A C 6: 131,168,284 noncoding transcript Het
Gpr6 G A 10: 41,071,172 S138L possibly damaging Het
Hesx1 C A 14: 27,000,845 H42Q possibly damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Kctd19 T C 8: 105,385,172 T31A probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krtap19-3 T C 16: 88,877,975 probably benign Het
Lin28a T A 4: 134,018,154 I43F probably benign Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 A G 4: 123,368,815 probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,330,715 L425P probably damaging Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Mybpc1 T G 10: 88,551,452 T466P probably damaging Het
Myo10 T C 15: 25,781,799 Y1127H probably benign Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Myo9b T C 8: 71,333,699 Y670H probably damaging Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Neurod2 G T 11: 98,327,588 A250E possibly damaging Het
Nipsnap1 C A 11: 4,888,932 N119K probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Olfr330 T C 11: 58,529,611 D125G probably damaging Het
Olfr479 T A 7: 108,055,904 N307K probably benign Het
Olfr748 A G 14: 50,710,636 Y102C probably damaging Het
Pald1 A G 10: 61,348,306 probably null Het
Palld T C 8: 61,877,361 S161G probably benign Het
Paqr9 T A 9: 95,561,069 F371I probably benign Het
Pear1 A T 3: 87,758,359 C120* probably null Het
Pla2g4e A T 2: 120,182,811 F343I probably damaging Het
Plxdc2 A T 2: 16,512,091 Y61F probably benign Het
Polh G A 17: 46,188,088 Q234* probably null Het
Prkce T A 17: 86,496,035 M454K possibly damaging Het
Proser1 C A 3: 53,477,945 T416K probably benign Het
Prr14l G T 5: 32,831,828 probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rp1l1 T A 14: 64,028,966 V667D possibly damaging Het
Rpp40 A T 13: 35,898,621 C256* probably null Het
Rps6ka5 A G 12: 100,678,538 L51P probably damaging Het
Rtp2 C T 16: 23,927,707 C78Y probably damaging Het
Ryr3 A G 2: 112,678,370 probably benign Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc6a21 T G 7: 45,282,773 probably null Het
Slc9a3r1 A T 11: 115,176,444 I174F probably damaging Het
Smo A G 6: 29,757,314 Y476C probably damaging Het
Tacr3 A T 3: 134,854,860 T187S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tasp1 T C 2: 140,048,244 K71E possibly damaging Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem41a T C 16: 21,946,161 probably null Het
Tmem63a A G 1: 180,965,540 N459D probably benign Het
Ube2k A G 5: 65,594,926 T151A probably damaging Het
Ubr1 T C 2: 120,942,553 E402G probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Wdr17 C T 8: 54,632,381 V1236M probably damaging Het
Zbtb32 T C 7: 30,591,493 K126E possibly damaging Het
Zeb1 A T 18: 5,767,681 S731C possibly damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATGAACACCTGTCAGC -3'
(R):5'- GGATTCAGACAAAATGCTACCTAC -3'

Sequencing Primer
(F):5'- TCAGCCCGACACACGTG -3'
(R):5'- GAACATAGACGGAGCCATA -3'
Posted On2014-09-17