Incidental Mutation 'R2129:Lrriq1'
ID 227860
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms Gm1557, LOC380658, 4930503E15Rik
MMRRC Submission 040132-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R2129 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 102881892-103072183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103050718 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 678 (T678I)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect probably benign
Transcript: ENSMUST00000020043
AA Change: T678I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: T678I

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123364
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166240
AA Change: T678I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: T678I

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220380
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (91/92)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,066,066 (GRCm39) E249G possibly damaging Het
2610028H24Rik A G 10: 76,293,349 (GRCm39) M136V possibly damaging Het
4930523C07Rik A T 1: 159,902,945 (GRCm39) K72* probably null Het
Abhd14a A T 9: 106,318,064 (GRCm39) L125Q probably null Het
Abhd17b T A 19: 21,658,413 (GRCm39) probably null Het
Abo G A 2: 26,736,586 (GRCm39) T61I probably benign Het
Adamts15 T C 9: 30,815,799 (GRCm39) T686A probably benign Het
Adgrv1 A T 13: 81,705,199 (GRCm39) F1537Y probably damaging Het
Anxa2 A T 9: 69,383,410 (GRCm39) Y75F possibly damaging Het
Aqp3 T A 4: 41,098,061 (GRCm39) I17F probably benign Het
Aspm T C 1: 139,385,373 (GRCm39) V339A probably benign Het
Bri3bp T A 5: 125,528,735 (GRCm39) L48* probably null Het
Car7 T A 8: 105,275,605 (GRCm39) C185S possibly damaging Het
Casp8ap2 T C 4: 32,640,142 (GRCm39) Y399H probably benign Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Chst10 A G 1: 38,904,776 (GRCm39) Y203H probably benign Het
Clca3a1 T C 3: 144,722,526 (GRCm39) D282G probably damaging Het
Coq3 T G 4: 21,900,342 (GRCm39) S190A probably benign Het
Crocc G A 4: 140,744,407 (GRCm39) R1830C probably damaging Het
Cygb A G 11: 116,540,668 (GRCm39) L106P probably damaging Het
Dab2 G T 15: 6,365,864 (GRCm39) E87* probably null Het
Dcst1 T A 3: 89,264,852 (GRCm39) I299F probably damaging Het
Dennd4a T G 9: 64,813,256 (GRCm39) probably null Het
Depdc7 A G 2: 104,558,518 (GRCm39) S168P probably benign Het
Dicer1 G A 12: 104,688,290 (GRCm39) T429I probably damaging Het
Dnah5 A G 15: 28,408,467 (GRCm39) Q3484R probably benign Het
Dock2 T C 11: 34,618,242 (GRCm39) M125V probably damaging Het
Dync2h1 A G 9: 7,175,289 (GRCm39) S107P possibly damaging Het
Emb T C 13: 117,404,082 (GRCm39) V278A probably damaging Het
Firrm T C 1: 163,794,026 (GRCm39) Y518C probably damaging Het
Foxk1 C A 5: 142,420,943 (GRCm39) S189* probably null Het
Galm T C 17: 80,490,647 (GRCm39) I268T probably benign Het
Gm5581 A C 6: 131,145,247 (GRCm39) noncoding transcript Het
Gpr6 G A 10: 40,947,168 (GRCm39) S138L possibly damaging Het
Hesx1 C A 14: 26,722,802 (GRCm39) H42Q possibly damaging Het
Hsp90b1 T C 10: 86,531,570 (GRCm39) D421G probably damaging Het
Kctd19 T C 8: 106,111,804 (GRCm39) T31A probably damaging Het
Kif1b G A 4: 149,272,097 (GRCm39) S1568L possibly damaging Het
Krtap19-3 T C 16: 88,674,863 (GRCm39) probably benign Het
Lin28a T A 4: 133,745,465 (GRCm39) I43F probably benign Het
Macf1 A G 4: 123,262,608 (GRCm39) probably benign Het
Madcam1 A G 10: 79,501,406 (GRCm39) E157G possibly damaging Het
Mctp1 A G 13: 76,972,941 (GRCm39) D648G probably damaging Het
Megf8 T C 7: 25,030,140 (GRCm39) L425P probably damaging Het
Mospd4 A G 18: 46,598,731 (GRCm39) noncoding transcript Het
Mybpc1 T G 10: 88,387,314 (GRCm39) T466P probably damaging Het
Myo10 T C 15: 25,781,885 (GRCm39) Y1127H probably benign Het
Myo18b A T 5: 112,978,944 (GRCm39) L1223Q probably damaging Het
Myo9b T C 8: 71,786,343 (GRCm39) Y670H probably damaging Het
Ndufaf4 G T 4: 24,898,608 (GRCm39) D55Y probably damaging Het
Neurod2 G T 11: 98,218,414 (GRCm39) A250E possibly damaging Het
Nherf1 A T 11: 115,067,270 (GRCm39) I174F probably damaging Het
Nipsnap1 C A 11: 4,838,932 (GRCm39) N119K probably benign Het
Npffr2 A T 5: 89,715,924 (GRCm39) I84F probably damaging Het
Or10ab4 T A 7: 107,655,111 (GRCm39) N307K probably benign Het
Or11h23 A G 14: 50,948,093 (GRCm39) Y102C probably damaging Het
Or2t48 T C 11: 58,420,437 (GRCm39) D125G probably damaging Het
Pald1 A G 10: 61,184,085 (GRCm39) probably null Het
Palld T C 8: 62,330,395 (GRCm39) S161G probably benign Het
Paqr9 T A 9: 95,443,122 (GRCm39) F371I probably benign Het
Pear1 A T 3: 87,665,666 (GRCm39) C120* probably null Het
Pla2g4e A T 2: 120,013,292 (GRCm39) F343I probably damaging Het
Plxdc2 A T 2: 16,516,902 (GRCm39) Y61F probably benign Het
Polh G A 17: 46,499,014 (GRCm39) Q234* probably null Het
Prkce T A 17: 86,803,463 (GRCm39) M454K possibly damaging Het
Proser1 C A 3: 53,385,366 (GRCm39) T416K probably benign Het
Prr14l G T 5: 32,989,172 (GRCm39) probably benign Het
Rabgap1l A T 1: 160,566,527 (GRCm39) D90E probably benign Het
Rp1l1 T A 14: 64,266,415 (GRCm39) V667D possibly damaging Het
Rpp40 A T 13: 36,082,604 (GRCm39) C256* probably null Het
Rps6ka5 A G 12: 100,644,797 (GRCm39) L51P probably damaging Het
Rtp2 C T 16: 23,746,457 (GRCm39) C78Y probably damaging Het
Ryr3 A G 2: 112,508,715 (GRCm39) probably benign Het
Slc10a6 A G 5: 103,756,922 (GRCm39) Y281H probably benign Het
Slc6a21 T G 7: 44,932,197 (GRCm39) probably null Het
Smo A G 6: 29,757,313 (GRCm39) Y476C probably damaging Het
Tacr3 A T 3: 134,560,621 (GRCm39) T187S probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tasp1 T C 2: 139,890,164 (GRCm39) K71E possibly damaging Het
Tg A G 15: 66,566,743 (GRCm39) I1264V probably benign Het
Tmem41a T C 16: 21,764,911 (GRCm39) probably null Het
Tmem63a A G 1: 180,793,105 (GRCm39) N459D probably benign Het
Ube2k A G 5: 65,752,269 (GRCm39) T151A probably damaging Het
Ubr1 T C 2: 120,773,034 (GRCm39) E402G probably benign Het
Ulk4 T A 9: 120,981,248 (GRCm39) I897F probably benign Het
Usp30 A G 5: 114,249,224 (GRCm39) E176G probably damaging Het
Utp20 A G 10: 88,649,917 (GRCm39) F431S probably damaging Het
Vmn1r206 T C 13: 22,804,782 (GRCm39) S142G probably benign Het
Wdr17 C T 8: 55,085,416 (GRCm39) V1236M probably damaging Het
Zbtb32 T C 7: 30,290,918 (GRCm39) K126E possibly damaging Het
Zeb1 A T 18: 5,767,681 (GRCm39) S731C possibly damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 102,997,757 (GRCm39) missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103,053,977 (GRCm39) nonsense probably null
IGL01637:Lrriq1 APN 10 103,051,489 (GRCm39) missense probably benign
IGL02019:Lrriq1 APN 10 103,014,661 (GRCm39) missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103,006,340 (GRCm39) missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103,060,802 (GRCm39) missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103,070,024 (GRCm39) splice site probably benign
IGL02408:Lrriq1 APN 10 102,982,142 (GRCm39) missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103,036,500 (GRCm39) missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103,050,880 (GRCm39) missense probably benign 0.02
IGL02558:Lrriq1 APN 10 102,982,144 (GRCm39) missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 102,980,409 (GRCm39) missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103,057,322 (GRCm39) critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103,063,057 (GRCm39) missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 102,907,055 (GRCm39) missense probably benign 0.26
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103,006,281 (GRCm39) critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103,051,634 (GRCm39) missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103,057,150 (GRCm39) missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 102,904,829 (GRCm39) splice site probably null
R0522:Lrriq1 UTSW 10 102,997,638 (GRCm39) missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103,069,905 (GRCm39) missense probably benign
R1220:Lrriq1 UTSW 10 102,906,990 (GRCm39) missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103,038,376 (GRCm39) splice site probably benign
R1642:Lrriq1 UTSW 10 103,050,317 (GRCm39) missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103,050,685 (GRCm39) missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103,006,509 (GRCm39) nonsense probably null
R1830:Lrriq1 UTSW 10 102,997,620 (GRCm39) missense probably benign
R1843:Lrriq1 UTSW 10 103,063,034 (GRCm39) splice site probably null
R2128:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2199:Lrriq1 UTSW 10 102,904,774 (GRCm39) missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103,025,848 (GRCm39) missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103,038,242 (GRCm39) missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103,050,536 (GRCm39) missense probably benign 0.00
R2939:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R3081:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103,006,294 (GRCm39) missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103,006,717 (GRCm39) missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103,051,967 (GRCm39) missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103,038,225 (GRCm39) missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103,057,288 (GRCm39) missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103,036,424 (GRCm39) nonsense probably null
R4663:Lrriq1 UTSW 10 102,899,273 (GRCm39) missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103,051,610 (GRCm39) missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103,006,327 (GRCm39) missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4815:Lrriq1 UTSW 10 102,980,739 (GRCm39) missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103,014,649 (GRCm39) missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103,069,899 (GRCm39) missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 102,997,613 (GRCm39) missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103,023,314 (GRCm39) missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103,051,206 (GRCm39) missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103,050,448 (GRCm39) missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103,006,457 (GRCm39) missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103,051,301 (GRCm39) missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103,009,236 (GRCm39) missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103,057,243 (GRCm39) nonsense probably null
R6008:Lrriq1 UTSW 10 103,006,325 (GRCm39) missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103,051,395 (GRCm39) missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103,051,618 (GRCm39) missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103,051,312 (GRCm39) missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103,009,254 (GRCm39) missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103,036,559 (GRCm39) missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103,063,045 (GRCm39) missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103,057,293 (GRCm39) missense probably benign 0.06
R6719:Lrriq1 UTSW 10 102,906,977 (GRCm39) missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103,017,750 (GRCm39) critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103,050,800 (GRCm39) missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103,023,319 (GRCm39) missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103,060,826 (GRCm39) missense probably benign
R7241:Lrriq1 UTSW 10 103,051,834 (GRCm39) missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103,059,611 (GRCm39) missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103,051,877 (GRCm39) missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103,057,185 (GRCm39) missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103,050,380 (GRCm39) missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103,050,807 (GRCm39) missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103,036,432 (GRCm39) missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103,036,462 (GRCm39) missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103,051,815 (GRCm39) missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103,051,678 (GRCm39) missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103,051,055 (GRCm39) nonsense probably null
R8131:Lrriq1 UTSW 10 103,051,572 (GRCm39) missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 102,992,196 (GRCm39) critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103,006,408 (GRCm39) missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103,069,929 (GRCm39) missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103,050,914 (GRCm39) missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 102,882,016 (GRCm39) missense
R9013:Lrriq1 UTSW 10 103,050,931 (GRCm39) missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103,051,864 (GRCm39) missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103,050,640 (GRCm39) missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103,057,144 (GRCm39) missense probably benign
R9384:Lrriq1 UTSW 10 103,006,458 (GRCm39) missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103,051,250 (GRCm39) missense probably benign
R9706:Lrriq1 UTSW 10 102,881,902 (GRCm39) missense
R9780:Lrriq1 UTSW 10 103,025,824 (GRCm39) missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103,051,565 (GRCm39) nonsense probably null
Z1088:Lrriq1 UTSW 10 103,038,307 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,069,946 (GRCm39) missense probably damaging 0.99
Z1176:Lrriq1 UTSW 10 103,038,221 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,038,220 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAAAGATTTCAGCCCAGG -3'
(R):5'- TTTCCATGCAGAAAAGCCTACC -3'

Sequencing Primer
(F):5'- GATTTCAGCCCAGGGTTTAAATG -3'
(R):5'- TGCAGAAAAGCCTACCATCACTG -3'
Posted On 2014-09-17