Incidental Mutation 'R0152:Usp3'
ID22790
Institutional Source Beutler Lab
Gene Symbol Usp3
Ensembl Gene ENSMUSG00000032376
Gene Nameubiquitin specific peptidase 3
Synonyms
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R0152 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location66514637-66593142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66540150 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 181 (T181A)
Ref Sequence ENSEMBL: ENSMUSP00000134472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098613] [ENSMUST00000127569] [ENSMUST00000139547] [ENSMUST00000174387]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034940
Predicted Effect possibly damaging
Transcript: ENSMUST00000098613
AA Change: T187A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096213
Gene: ENSMUSG00000032376
AA Change: T187A

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 6.6e-23 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 188 1.1e-8 PFAM
Pfam:UCH 178 470 4.2e-54 PFAM
Pfam:UCH_1 193 452 3.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124694
Predicted Effect possibly damaging
Transcript: ENSMUST00000127569
AA Change: T225A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122199
Gene: ENSMUSG00000032376
AA Change: T225A

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 1.2e-22 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 508 2.5e-61 PFAM
Pfam:UCH_1 206 490 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139547
Predicted Effect probably damaging
Transcript: ENSMUST00000174387
AA Change: T181A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134472
Gene: ENSMUSG00000032376
AA Change: T181A

DomainStartEndE-ValueType
Pfam:zf-UBP 29 142 1.6e-7 PFAM
Pfam:UCH 114 464 9.9e-69 PFAM
Pfam:UCH_1 115 446 2e-26 PFAM
Meta Mutation Damage Score 0.1251 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype FUNCTION: The protein encoded by this gene is a chromatin-associated histone 2A and 2B deubiquitinating enzyme that negatively regulates the DNA damage response. Mice deficient for this enzyme have reduced hematopoietic stem cell reserves, demonstrating a requirement in hematopoietic stem cell homeostasis. In addition, knock down of protein levels results in spontaneous tumor development and shortened lifespan, consistent with a function in preserving chromosomal integrity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Usp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Usp3 APN 9 66562552 critical splice donor site probably null
IGL02951:Usp3 APN 9 66542550 nonsense probably null
IGL03283:Usp3 APN 9 66562549 splice site probably null
R0148:Usp3 UTSW 9 66540167 missense possibly damaging 0.80
R0184:Usp3 UTSW 9 66562581 missense probably damaging 0.99
R0628:Usp3 UTSW 9 66518444 missense probably benign 0.05
R1036:Usp3 UTSW 9 66530231 splice site probably benign
R2251:Usp3 UTSW 9 66562578 missense probably damaging 0.99
R2437:Usp3 UTSW 9 66545742 critical splice donor site probably null
R3957:Usp3 UTSW 9 66562591 missense probably benign 0.04
R4320:Usp3 UTSW 9 66530248 missense possibly damaging 0.80
R4439:Usp3 UTSW 9 66518494 missense probably benign 0.00
R4562:Usp3 UTSW 9 66520765 intron probably benign
R4659:Usp3 UTSW 9 66527070 splice site probably null
R4742:Usp3 UTSW 9 66520677 missense probably damaging 1.00
R5134:Usp3 UTSW 9 66542532 missense possibly damaging 0.82
R5242:Usp3 UTSW 9 66527150 missense probably damaging 1.00
R5556:Usp3 UTSW 9 66544021 missense possibly damaging 0.88
R6949:Usp3 UTSW 9 66520690 missense probably benign 0.37
R7440:Usp3 UTSW 9 66530255 missense probably benign 0.03
R7452:Usp3 UTSW 9 66566898 missense probably benign 0.11
R7547:Usp3 UTSW 9 66542624 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGCACACATGGGCTACTCACTAGG -3'
(R):5'- GCTTTGCTTGTGAACGATCCACTG -3'

Sequencing Primer
(F):5'- AATAAGCCAGTGTTTACTCAGTCCC -3'
(R):5'- GTGAACGATCCACTGCTTTATG -3'
Posted On2013-04-16