Incidental Mutation 'R0152:Zbtb38'
ID22791
Institutional Source Beutler Lab
Gene Symbol Zbtb38
Ensembl Gene ENSMUSG00000040433
Gene Namezinc finger and BTB domain containing 38
SynonymsCIBZ, A930014K01Rik, Zenon homolog
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R0152 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location96682770-96752831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96686280 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 917 (Y917C)
Ref Sequence ENSEMBL: ENSMUSP00000121753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]
Predicted Effect probably damaging
Transcript: ENSMUST00000093798
AA Change: Y917C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: Y917C

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126066
AA Change: Y917C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433
AA Change: Y917C

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128269
SMART Domains Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140121
SMART Domains Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152594
AA Change: Y917C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: Y917C

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Zbtb38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zbtb38 APN 9 96687494 missense probably damaging 1.00
IGL01895:Zbtb38 APN 9 96688408 missense probably benign 0.00
IGL02513:Zbtb38 APN 9 96687073 missense probably damaging 1.00
IGL02649:Zbtb38 APN 9 96686619 missense probably damaging 0.96
IGL02938:Zbtb38 APN 9 96687174 missense probably benign 0.11
PIT4131001:Zbtb38 UTSW 9 96686316 missense probably damaging 1.00
R0048:Zbtb38 UTSW 9 96687676 missense probably damaging 1.00
R0158:Zbtb38 UTSW 9 96686940 missense possibly damaging 0.46
R0519:Zbtb38 UTSW 9 96685773 missense probably damaging 1.00
R0594:Zbtb38 UTSW 9 96685954 missense probably damaging 1.00
R1556:Zbtb38 UTSW 9 96686991 missense probably benign 0.26
R1698:Zbtb38 UTSW 9 96685462 missense probably benign
R1772:Zbtb38 UTSW 9 96688041 missense probably damaging 1.00
R1799:Zbtb38 UTSW 9 96688881 missense probably damaging 1.00
R1837:Zbtb38 UTSW 9 96686995 missense probably benign
R2446:Zbtb38 UTSW 9 96687646 missense probably damaging 1.00
R3153:Zbtb38 UTSW 9 96688249 missense probably benign 0.34
R3950:Zbtb38 UTSW 9 96687546 missense probably damaging 1.00
R4240:Zbtb38 UTSW 9 96686102 small deletion probably benign
R4630:Zbtb38 UTSW 9 96688851 missense probably damaging 1.00
R4666:Zbtb38 UTSW 9 96688383 missense probably damaging 1.00
R4732:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4733:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4824:Zbtb38 UTSW 9 96688201 missense probably benign 0.06
R5006:Zbtb38 UTSW 9 96685651 missense probably damaging 1.00
R5109:Zbtb38 UTSW 9 96687009 missense probably damaging 0.99
R5251:Zbtb38 UTSW 9 96687108 missense probably benign 0.43
R5396:Zbtb38 UTSW 9 96687643 missense probably damaging 1.00
R5659:Zbtb38 UTSW 9 96687420 missense probably damaging 1.00
R6249:Zbtb38 UTSW 9 96685992 missense probably damaging 0.99
R6294:Zbtb38 UTSW 9 96687229 missense probably benign 0.05
R6615:Zbtb38 UTSW 9 96686654 nonsense probably null
R6625:Zbtb38 UTSW 9 96687313 missense probably damaging 1.00
R6885:Zbtb38 UTSW 9 96686464 missense probably damaging 1.00
R7304:Zbtb38 UTSW 9 96687427 missense probably damaging 0.96
R7675:Zbtb38 UTSW 9 96685541 missense probably benign 0.00
R7823:Zbtb38 UTSW 9 96685976 nonsense probably null
R7900:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
R7983:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
X0066:Zbtb38 UTSW 9 96687612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGATGAACTCCTTCACGCCC -3'
(R):5'- AATGCAGGAAGAGACACTGCCTCG -3'

Sequencing Primer
(F):5'- GGCATCTCTTTATTCtcttcttcttc -3'
(R):5'- ACTGCCTCGGGAGAATGAC -3'
Posted On2013-04-16