Incidental Mutation 'R0152:Mfsd12'
ID22792
Institutional Source Beutler Lab
Gene Symbol Mfsd12
Ensembl Gene ENSMUSG00000034854
Gene Namemajor facilitator superfamily domain containing 12
SynonymsWdt1, F630110N24Rik
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R0152 (G1)
Quality Score195
Status Not validated
Chromosome10
Chromosomal Location81357491-81366225 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81357799 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 68 (D68Y)
Ref Sequence ENSEMBL: ENSMUSP00000120259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044844] [ENSMUST00000132368]
Predicted Effect probably damaging
Transcript: ENSMUST00000044844
AA Change: D68Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036116
Gene: ENSMUSG00000034854
AA Change: D68Y

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:MFS_2 20 423 5.2e-43 PFAM
Pfam:MFS_1 154 416 6.8e-12 PFAM
transmembrane domain 441 463 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132368
AA Change: D68Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120259
Gene: ENSMUSG00000034854
AA Change: D68Y

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:MFS_2 20 102 3.7e-11 PFAM
low complexity region 118 124 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit a grey (grizzled) coat. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Mfsd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01556:Mfsd12 APN 10 81363024 missense probably damaging 0.98
IGL01928:Mfsd12 APN 10 81365788 unclassified probably benign
P0038:Mfsd12 UTSW 10 81362218 missense probably benign 0.02
R0048:Mfsd12 UTSW 10 81362814 missense possibly damaging 0.77
R0048:Mfsd12 UTSW 10 81362814 missense possibly damaging 0.77
R0317:Mfsd12 UTSW 10 81357799 missense probably damaging 1.00
R0565:Mfsd12 UTSW 10 81361409 missense probably benign 0.00
R1283:Mfsd12 UTSW 10 81361435 missense probably benign 0.00
R1927:Mfsd12 UTSW 10 81362087 missense probably benign 0.15
R1983:Mfsd12 UTSW 10 81362256 splice site probably null
R1994:Mfsd12 UTSW 10 81357681 missense probably damaging 1.00
R1995:Mfsd12 UTSW 10 81357681 missense probably damaging 1.00
R2055:Mfsd12 UTSW 10 81360229 missense probably damaging 1.00
R2197:Mfsd12 UTSW 10 81357734 missense probably damaging 1.00
R3120:Mfsd12 UTSW 10 81361215 missense probably benign 0.00
R4162:Mfsd12 UTSW 10 81361097 critical splice acceptor site probably null
R4163:Mfsd12 UTSW 10 81361097 critical splice acceptor site probably null
R4417:Mfsd12 UTSW 10 81364703 unclassified probably benign
R5622:Mfsd12 UTSW 10 81363627 missense probably null 0.98
R6407:Mfsd12 UTSW 10 81362233 splice site probably null
R7759:Mfsd12 UTSW 10 81363593 missense probably benign 0.10
R7780:Mfsd12 UTSW 10 81357884 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCTATGATAAAAGTCGGAGCCGCAG -3'
(R):5'- AGGACTTCCACAGGGCGACAAC -3'

Sequencing Primer
(F):5'- GCCTCCTCTTGCTGATTGGG -3'
(R):5'- ACACAGGGCGGCATTCAG -3'
Posted On2013-04-16