Incidental Mutation 'R0152:Recql5'
ID22795
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R0152 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115894673 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 666 (S666P)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000093911] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000021097
AA Change: S666P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: S666P

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136774
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147172
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8025:Recql5 UTSW 11 115928112 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
R8316:Recql5 UTSW 11 115894035 missense possibly damaging 0.46
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTGGCTCTAGCTTTGGCAC -3'
(R):5'- TAGGTTCAGGGAAGACTCCACTGC -3'

Sequencing Primer
(F):5'- CTGGGAAGACCCTTTCGTC -3'
(R):5'- CTCCCAGATGTCAGAAAGGGTC -3'
Posted On2013-04-16