Mutagenetix > Incidental Mutations

Incidental Mutation 'R2130:Zfyve26'

227982

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, LOC380767, 9330197E15Rik

MMRRC Submission

040133-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2130 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79232346-79296304 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79268434 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1423 (I1423F)

Ref Sequence

ENSEMBL: ENSMUSP00000021547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377] [ENSMUST00000219912]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021547
AA Change: I1423F

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: I1423F

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218377

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219842

Predicted Effect

probably benign
Transcript: ENSMUST00000219912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220262

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

94% (94/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,210,149	C656S	probably benign	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
A2ml1	T	A	6: 128,576,260	N178I	probably damaging	Het
Adgrl2	T	C	3: 148,890,488	I71V	probably damaging	Het
Adgrv1	T	C	13: 81,581,727	T212A	possibly damaging	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Apaf1	A	T	10: 91,060,165	Y348*	probably null	Het
Apobr	A	G	7: 126,587,206	T630A	probably benign	Het
Arhgap23	A	G	11: 97,451,561	D223G	possibly damaging	Het
Asic1	A	T	15: 99,671,875	T26S	possibly damaging	Het
Atp13a2	T	A	4: 141,005,016	M864K	probably damaging	Het
Atrnl1	G	A	19: 57,654,994	G438D	probably damaging	Het
Bbc3	T	C	7: 16,312,343	V68A	possibly damaging	Het
Birc6	T	C	17: 74,659,154		probably benign	Het
Btnl9	A	G	11: 49,180,696	F100S	probably damaging	Het
Ccpg1	A	G	9: 73,013,158	N685S	probably damaging	Het
Ces3b	T	A	8: 105,092,975		probably null	Het
Cfhr2	T	G	1: 139,831,155	R52S	probably benign	Het
Clhc1	A	G	11: 29,557,663	I126V	probably benign	Het
Crocc	T	C	4: 141,029,102	I1071V	probably benign	Het
Dbt	T	A	3: 116,539,124	D16E	probably damaging	Het
Dnajc8	T	C	4: 132,544,059	S62P	possibly damaging	Het
Dpyd	T	C	3: 118,674,568	V77A	probably benign	Het
Dram2	T	A	3: 106,570,760	M136K	possibly damaging	Het
Dtx2	T	A	5: 136,012,040	F100I	probably damaging	Het
Dync2h1	A	T	9: 7,011,253	W3654R	probably damaging	Het
Fam129b	A	G	2: 32,923,647	K624R	probably benign	Het
Fam208a	T	A	14: 27,446,388	Y296N	probably damaging	Het
Fam208a	A	G	14: 27,476,614	N1301S	possibly damaging	Het
Fbxw10	T	A	11: 62,859,857	I422N	probably damaging	Het
Fgf17	T	C	14: 70,638,487	R102G	probably damaging	Het
Gatsl2	G	A	5: 134,136,153	C187Y	probably damaging	Het
Gm28040	AGTG	AGTGGCACCTTTGGTG	1: 133,327,321		probably benign	Het
Gm6578	C	A	6: 12,100,187		noncoding transcript	Het
Gm8298	T	C	3: 59,865,348	V91A	probably damaging	Het
Gm8374	T	C	14: 7,364,194	T49A	probably damaging	Het
Gm9797	G	T	10: 11,609,369		noncoding transcript	Het
Golga3	T	C	5: 110,202,939		probably null	Het
Golim4	A	T	3: 75,908,149	V116D	probably damaging	Het
Igfn1	AGGG	AGG	1: 135,974,852		probably benign	Het
Insrr	G	A	3: 87,810,572		probably null	Het
Ipo9	ATCCTCCTCCTCCTCCTC	ATCCTCCTCCTCCTCCTCCTC	1: 135,386,268		probably benign	Het
Ipo9	A	G	1: 135,402,250	V484A	probably benign	Het
Isoc2b	A	T	7: 4,851,439	I31N	probably damaging	Het
Kif5c	T	A	2: 49,758,805		probably benign	Het
Krtap16-1	A	T	11: 99,985,776	C267*	probably null	Het
Lamc2	T	A	1: 153,127,124	D1037V	probably damaging	Het
Lhfpl2	A	G	13: 94,192,049	D206G	possibly damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Mgat2	T	C	12: 69,185,294	F214S	probably damaging	Het
Mki67	T	A	7: 135,704,241		probably null	Het
Mpo	A	G	11: 87,797,361	D282G	possibly damaging	Het
Myh10	A	G	11: 68,807,289		probably benign	Het
Myo15b	G	A	11: 115,871,643	V1229I	probably benign	Het
Nfatc2ip	A	G	7: 126,390,462	V250A	probably benign	Het
Nrp1	A	T	8: 128,498,516	E782D	probably damaging	Het
Olfml3	T	A	3: 103,735,869	M399L	probably benign	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr453	C	A	6: 42,744,135	L33M	possibly damaging	Het
Olfr683	T	A	7: 105,143,550	I254F	probably benign	Het
Optc	A	T	1: 133,903,796		probably null	Het
Plekha6	C	A	1: 133,279,365		probably null	Het
Prelp	C	T	1: 133,915,131	R92K	probably benign	Het
Psph	T	A	5: 129,787,539		probably null	Het
Ptpro	A	G	6: 137,411,116		probably null	Het
Pzp	T	C	6: 128,491,161		probably null	Het
Qrich2	C	T	11: 116,448,417		probably benign	Het
Ren1	C	G	1: 133,350,778		probably null	Het
Rfwd3	A	T	8: 111,297,402	V96E	probably benign	Het
Rnf17	T	C	14: 56,493,354	V1205A	probably damaging	Het
Senp1	T	A	15: 98,075,967	T132S	probably benign	Het
Sgo2b	T	C	8: 63,927,147	R884G	probably benign	Het
Slc10a5	G	T	3: 10,335,218	D127E	probably benign	Het
Slc25a35	T	G	11: 68,968,965	S101R	possibly damaging	Het
Slc6a13	T	C	6: 121,325,041	L194P	possibly damaging	Het
Snw1	T	G	12: 87,452,703		probably benign	Het
Sort1	T	A	3: 108,351,686	F678Y	probably benign	Het
Srsf12	C	T	4: 33,225,764		probably benign	Het
Ssxa1	T	A	X: 21,119,342		probably benign	Het
Stard13	T	C	5: 151,045,168	Y879C	probably damaging	Het
Syt2	ACTCTCTCT	ACTCTCTCTCT	1: 134,746,741		probably benign	Het
Tacr3	T	C	3: 134,932,180	V366A	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tkfc	A	G	19: 10,596,041	I279T	probably damaging	Het
Tmem98	A	G	11: 80,817,522	E106G	probably damaging	Het
Tnnt2	TG	TGG	1: 135,846,761		probably benign	Het
Trim41	C	A	11: 48,807,592	G516W	probably damaging	Het
Trove2	T	C	1: 143,760,034	D458G	probably benign	Het
Ttn	T	C	2: 76,742,517	T24265A	possibly damaging	Het
Usp37	A	G	1: 74,461,656	V582A	probably damaging	Het
Vps13b	T	A	15: 35,671,400	I1683N	probably benign	Het
Vps13d	C	T	4: 145,156,101	R968H	probably benign	Het
Vwf	C	T	6: 125,657,057	T166I	probably damaging	Het
Zfp280d	T	C	9: 72,308,005	F133L	probably damaging	Het
Zfp459	A	T	13: 67,408,276	H229Q	probably benign	Het
Zmynd19	T	A	2: 24,952,636	Y15*	probably null	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79249460	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79280900	missense	probably benign
IGL01148:Zfyve26	APN	12	79260870	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79252183	splice site	probably null
IGL01472:Zfyve26	APN	12	79276343	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79244373	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79287851	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79261574	splice site	probably null
IGL01689:Zfyve26	APN	12	79284053	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79287444	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79244400	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79276395	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79268847	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79280080	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79239020	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79263870	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79261791	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79295564	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79284072	nonsense	probably null
IGL02799:Zfyve26	UTSW	12	79273310	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79276281	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79244484	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79246222	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79268728	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79265802	splice site	probably benign
R0738:Zfyve26	UTSW	12	79295534	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79273598	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79272127	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79263949	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79274920	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79282817	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79252163	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79252151	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79287761	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79238944	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79278463	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79269049	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79286258	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79264351	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79239970	nonsense	probably null
R1982:Zfyve26	UTSW	12	79255243	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79284032	splice site	probably null
R2071:Zfyve26	UTSW	12	79287446	missense	possibly damaging	0.95
R2132:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79246052	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79246087	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79275040	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79284116	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79282799	splice site	probably null
R3084:Zfyve26	UTSW	12	79265683	splice site	probably benign
R3086:Zfyve26	UTSW	12	79265683	splice site	probably benign
R4626:Zfyve26	UTSW	12	79269070	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79244396	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79249695	splice site	probably null
R4926:Zfyve26	UTSW	12	79275011	missense	probably benign
R4990:Zfyve26	UTSW	12	79287833	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79280385	nonsense	probably null
R5029:Zfyve26	UTSW	12	79286323	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79255361	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79280058	nonsense	probably null
R5252:Zfyve26	UTSW	12	79268982	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79270850	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79246521	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79239924	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79273373	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79264357	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79287737	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79266537	missense	probably benign	0.30
R6075:Zfyve26	UTSW	12	79293854	missense	possibly damaging	0.74
R6184:Zfyve26	UTSW	12	79268727	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79249599	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79282984	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79240002	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79238335	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79266449	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79284152	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79279114	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79280405	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79268408	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79246171	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79278372	splice site	probably null
R7299:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79251168	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79240054	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79287807	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79268676	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79290957	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79268635	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79280355	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79255324	missense	probably damaging	1.00
R8141:Zfyve26	UTSW	12	79268557	missense	possibly damaging	0.79
R8190:Zfyve26	UTSW	12	79280836	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79260831	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79255263	missense	probably damaging	1.00
RF010:Zfyve26	UTSW	12	79255338	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79239005	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79268533	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79287375	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTGATCATACCACAGTGAATGC -3'
(R):5'- TGACTGCAGAGAAGGTAGCC -3'

Sequencing Primer
(F):5'- CATACCACAGTGAATGCTAAGTG -3'
(R):5'- GCTAATTGGGAGCCTCTACAG -3'

Posted On

2014-09-17