Incidental Mutation 'R2131:Eya1'
ID 228002
Institutional Source Beutler Lab
Gene Symbol Eya1
Ensembl Gene ENSMUSG00000025932
Gene Name EYA transcriptional coactivator and phosphatase 1
Synonyms bor
MMRRC Submission 040134-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.860) question?
Stock # R2131 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 14239178-14380459 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14241198 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 573 (V573A)
Ref Sequence ENSEMBL: ENSMUSP00000141112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027066] [ENSMUST00000080664] [ENSMUST00000168081] [ENSMUST00000190337]
AlphaFold P97767
Predicted Effect probably benign
Transcript: ENSMUST00000027066
AA Change: V573A

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027066
Gene: ENSMUSG00000025932
AA Change: V573A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080664
AA Change: V540A

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079493
Gene: ENSMUSG00000025932
AA Change: V540A

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 256 280 N/A INTRINSIC
PDB:3HB1|D 281 552 1e-173 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168081
AA Change: V569A

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126383
Gene: ENSMUSG00000025932
AA Change: V569A

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 207 219 N/A INTRINSIC
low complexity region 262 286 N/A INTRINSIC
PDB:3HB1|D 287 558 1e-172 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190337
AA Change: V573A

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141112
Gene: ENSMUSG00000025932
AA Change: V573A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mutations in this locus affect inner ear morphology and hearing, and result in dysmorphic or absent kidneys. Hypomorphs are deaf and circle. Null homozygotes additionally show agenesis of thymus and parathyroid and thyroid hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Acvr2b A G 9: 119,261,874 (GRCm39) R437G probably damaging Het
Adamtsl3 C A 7: 82,227,802 (GRCm39) A1329E probably damaging Het
Adgrl2 T C 3: 148,596,124 (GRCm39) I71V probably damaging Het
Adra1a A T 14: 66,964,981 (GRCm39) I324F possibly damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Ampd1 G T 3: 103,002,194 (GRCm39) probably null Het
Ankrd16 T A 2: 11,788,506 (GRCm39) D211E probably damaging Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Apc C A 18: 34,445,098 (GRCm39) Q665K possibly damaging Het
Arap2 T C 5: 62,835,301 (GRCm39) N747S probably damaging Het
Arsk A T 13: 76,239,931 (GRCm39) C47* probably null Het
Atp8b5 T A 4: 43,370,726 (GRCm39) F1001I probably benign Het
Bap1 T A 14: 30,980,288 (GRCm39) Y645* probably null Het
Brca2 A G 5: 150,480,594 (GRCm39) Y2760C probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Castor2 G A 5: 134,164,992 (GRCm39) C187Y probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,120,763 (GRCm39) probably benign Het
Cdkn2c A C 4: 109,522,260 (GRCm39) N28K probably null Het
Celsr1 T A 15: 85,847,424 (GRCm39) I1438F probably benign Het
Cfhr2 T G 1: 139,758,893 (GRCm39) R52S probably benign Het
Cldn1 G C 16: 26,190,300 (GRCm39) A26G probably damaging Het
Col20a1 T A 2: 180,634,366 (GRCm39) F110L probably damaging Het
Creg2 T C 1: 39,664,146 (GRCm39) N204S probably benign Het
Cx3cl1 C A 8: 95,506,201 (GRCm39) Q69K probably benign Het
Cyfip2 T C 11: 46,176,958 (GRCm39) E74G possibly damaging Het
Cyp2g1 A T 7: 26,520,135 (GRCm39) I456F probably damaging Het
Dapk1 A G 13: 60,877,345 (GRCm39) E528G possibly damaging Het
Dapk1 T A 13: 60,909,481 (GRCm39) W1365R possibly damaging Het
Dbt T A 3: 116,332,773 (GRCm39) D16E probably damaging Het
Depdc5 T A 5: 33,148,125 (GRCm39) L1469* probably null Het
Dnah3 T A 7: 119,566,982 (GRCm39) T2415S possibly damaging Het
Dnmbp A G 19: 43,842,750 (GRCm39) L1210S probably damaging Het
Dpyd T C 3: 118,468,217 (GRCm39) V77A probably benign Het
Eps15l1 A T 8: 73,140,712 (GRCm39) V260D probably benign Het
Fam171b T A 2: 83,710,202 (GRCm39) S625T probably damaging Het
Fam186a T C 15: 99,831,557 (GRCm39) probably benign Het
Gabra4 G T 5: 71,798,567 (GRCm39) D137E probably benign Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm43302 T C 5: 105,422,610 (GRCm39) D474G probably damaging Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gpr19 T C 6: 134,847,405 (GRCm39) M1V probably null Het
Hnf4a T A 2: 163,389,338 (GRCm39) N29K probably benign Het
Htt A G 5: 35,034,453 (GRCm39) R1975G possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Il4i1 G A 7: 44,489,494 (GRCm39) V420M probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Jmjd4 A T 11: 59,345,781 (GRCm39) H287L probably damaging Het
Kcnj13 A G 1: 87,314,256 (GRCm39) V322A probably benign Het
Kdm5d T C Y: 941,483 (GRCm39) L1228P probably benign Het
Klra3 A G 6: 130,312,738 (GRCm39) S9P probably benign Het
Ldhd C T 8: 112,355,169 (GRCm39) probably null Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lmo7 A T 14: 102,137,674 (GRCm39) D670V probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lrp5 T C 19: 3,672,708 (GRCm39) T534A possibly damaging Het
Lrrc24 A T 15: 76,599,781 (GRCm39) F453I possibly damaging Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mcpt8 T C 14: 56,319,740 (GRCm39) I237V probably damaging Het
Med4 A G 14: 73,755,436 (GRCm39) N248S possibly damaging Het
Mest C T 6: 30,745,884 (GRCm39) L269F probably damaging Het
Mib2 C T 4: 155,739,695 (GRCm39) probably null Het
Mki67 T A 7: 135,305,970 (GRCm39) probably null Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Nbr1 T A 11: 101,457,017 (GRCm39) probably null Het
Ncapd3 T G 9: 26,994,642 (GRCm39) V1174G probably damaging Het
Nyap1 A C 5: 137,731,943 (GRCm39) probably null Het
Olfml3 T A 3: 103,643,185 (GRCm39) M399L probably benign Het
Oosp1 T C 19: 11,668,314 (GRCm39) D23G probably damaging Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or6c205 T C 10: 129,086,943 (GRCm39) F180S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Otog A T 7: 45,899,524 (GRCm39) N275I probably damaging Het
Pcdhb14 C A 18: 37,580,923 (GRCm39) Q10K probably benign Het
Pcx T C 19: 4,652,579 (GRCm39) F189L probably benign Het
Pde6b A G 5: 108,576,069 (GRCm39) D718G probably damaging Het
Pklr C A 3: 89,049,967 (GRCm39) P314Q probably damaging Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Plekho1 A G 3: 95,896,429 (GRCm39) S347P probably damaging Het
Plxna2 G A 1: 194,327,058 (GRCm39) D331N probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Prkra A T 2: 76,477,480 (GRCm39) I75K probably damaging Het
Ptpn11 G A 5: 121,310,089 (GRCm39) A31V probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Rbm12 A T 2: 155,937,430 (GRCm39) C947* probably null Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Sarm1 A T 11: 78,366,133 (GRCm39) C649S probably benign Het
Septin12 T A 16: 4,809,643 (GRCm39) Q223L probably damaging Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc22a21 A T 11: 53,870,559 (GRCm39) L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 (GRCm39) probably null Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Sort1 T A 3: 108,259,002 (GRCm39) F678Y probably benign Het
Spag6 T A 2: 18,737,908 (GRCm39) C259* probably null Het
Spata31e2 T C 1: 26,724,935 (GRCm39) R82G probably benign Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Stk24 A T 14: 121,539,623 (GRCm39) I191N probably damaging Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tacc2 T A 7: 130,223,587 (GRCm39) S91T possibly damaging Het
Tacr3 T C 3: 134,637,941 (GRCm39) V366A probably benign Het
Tasor A G 14: 27,198,571 (GRCm39) N1301S possibly damaging Het
Tbccd1 A G 16: 22,660,739 (GRCm39) S26P probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tor1aip2 A G 1: 155,941,095 (GRCm39) Y467C probably damaging Het
Ttc9b T A 7: 27,353,774 (GRCm39) probably null Het
Tti1 T C 2: 157,842,663 (GRCm39) R789G probably benign Het
Ttn A T 2: 76,662,561 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ube3d A T 9: 86,254,540 (GRCm39) probably null Het
Vav2 C A 2: 27,189,408 (GRCm39) R176L possibly damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Wdr27 T A 17: 15,148,594 (GRCm39) D133V probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp467 A C 6: 48,419,595 (GRCm39) S38A probably damaging Het
Other mutations in Eya1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Eya1 APN 1 14,340,925 (GRCm39) splice site probably benign
IGL01110:Eya1 APN 1 14,353,354 (GRCm39) missense probably damaging 1.00
IGL02266:Eya1 APN 1 14,254,725 (GRCm39) missense possibly damaging 0.63
IGL03027:Eya1 APN 1 14,241,190 (GRCm39) missense probably damaging 1.00
IGL03081:Eya1 APN 1 14,253,415 (GRCm39) missense possibly damaging 0.76
IGL03291:Eya1 APN 1 14,254,572 (GRCm39) critical splice donor site probably null
IGL03353:Eya1 APN 1 14,249,751 (GRCm39) missense probably damaging 1.00
R0042:Eya1 UTSW 1 14,254,713 (GRCm39) missense probably damaging 0.98
R0042:Eya1 UTSW 1 14,254,713 (GRCm39) missense probably damaging 0.98
R1428:Eya1 UTSW 1 14,374,638 (GRCm39) splice site probably benign
R1521:Eya1 UTSW 1 14,344,774 (GRCm39) missense probably damaging 0.99
R1571:Eya1 UTSW 1 14,279,141 (GRCm39) missense probably damaging 1.00
R1768:Eya1 UTSW 1 14,323,299 (GRCm39) missense possibly damaging 0.95
R1785:Eya1 UTSW 1 14,241,198 (GRCm39) missense probably benign 0.16
R1840:Eya1 UTSW 1 14,299,728 (GRCm39) nonsense probably null
R2114:Eya1 UTSW 1 14,340,998 (GRCm39) missense probably damaging 1.00
R2212:Eya1 UTSW 1 14,344,433 (GRCm39) critical splice acceptor site probably null
R2416:Eya1 UTSW 1 14,340,927 (GRCm39) critical splice donor site probably null
R2424:Eya1 UTSW 1 14,341,072 (GRCm39) splice site probably benign
R3085:Eya1 UTSW 1 14,344,314 (GRCm39) missense probably benign 0.01
R3158:Eya1 UTSW 1 14,374,691 (GRCm39) start gained probably benign
R3412:Eya1 UTSW 1 14,344,433 (GRCm39) critical splice acceptor site probably null
R3413:Eya1 UTSW 1 14,344,433 (GRCm39) critical splice acceptor site probably null
R3693:Eya1 UTSW 1 14,299,725 (GRCm39) missense probably damaging 1.00
R3694:Eya1 UTSW 1 14,299,725 (GRCm39) missense probably damaging 1.00
R3899:Eya1 UTSW 1 14,340,971 (GRCm39) missense probably benign 0.04
R4454:Eya1 UTSW 1 14,253,420 (GRCm39) missense probably damaging 0.98
R4455:Eya1 UTSW 1 14,253,420 (GRCm39) missense probably damaging 0.98
R4456:Eya1 UTSW 1 14,253,420 (GRCm39) missense probably damaging 0.98
R4458:Eya1 UTSW 1 14,253,420 (GRCm39) missense probably damaging 0.98
R4761:Eya1 UTSW 1 14,373,045 (GRCm39) missense probably damaging 1.00
R5011:Eya1 UTSW 1 14,254,582 (GRCm39) missense probably damaging 1.00
R5013:Eya1 UTSW 1 14,254,582 (GRCm39) missense probably damaging 1.00
R5613:Eya1 UTSW 1 14,373,153 (GRCm39) intron probably benign
R5687:Eya1 UTSW 1 14,253,476 (GRCm39) missense probably damaging 0.99
R6052:Eya1 UTSW 1 14,353,374 (GRCm39) missense probably damaging 1.00
R6181:Eya1 UTSW 1 14,373,096 (GRCm39) missense probably damaging 0.99
R6378:Eya1 UTSW 1 14,373,027 (GRCm39) missense possibly damaging 0.93
R6805:Eya1 UTSW 1 14,253,501 (GRCm39) missense probably benign 0.00
R6863:Eya1 UTSW 1 14,341,199 (GRCm39) splice site probably null
R7032:Eya1 UTSW 1 14,353,424 (GRCm39) critical splice acceptor site probably null
R7044:Eya1 UTSW 1 14,301,634 (GRCm39) splice site probably null
R7078:Eya1 UTSW 1 14,301,636 (GRCm39) critical splice donor site probably null
R7179:Eya1 UTSW 1 14,373,076 (GRCm39) missense probably damaging 1.00
R7384:Eya1 UTSW 1 14,299,736 (GRCm39) missense probably damaging 1.00
R7462:Eya1 UTSW 1 14,301,638 (GRCm39) missense probably null 0.99
R8490:Eya1 UTSW 1 14,254,899 (GRCm39) missense possibly damaging 0.90
R8527:Eya1 UTSW 1 14,322,672 (GRCm39) missense probably damaging 1.00
R8724:Eya1 UTSW 1 14,279,206 (GRCm39) missense probably benign 0.01
R9462:Eya1 UTSW 1 14,299,775 (GRCm39) missense probably damaging 1.00
R9608:Eya1 UTSW 1 14,373,029 (GRCm39) missense probably benign 0.10
Z1176:Eya1 UTSW 1 14,373,092 (GRCm39) missense probably damaging 1.00
Z1176:Eya1 UTSW 1 14,322,654 (GRCm39) missense probably benign
Z1177:Eya1 UTSW 1 14,323,314 (GRCm39) missense possibly damaging 0.68
Z1177:Eya1 UTSW 1 14,254,653 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGAAGAATACACATGGTCCTCC -3'
(R):5'- AGAGAAATGGCACTCCCCTC -3'

Sequencing Primer
(F):5'- GTCCTCCATTAACCCCGAGG -3'
(R):5'- CCTCACACAGTATTTCTTGGAGGGAG -3'
Posted On 2014-09-17