Mutagenetix > Incidental Mutation

Incidental Mutation 'R2131:Plxna2'

228022

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

040134-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2131 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 194644750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 331 (D331N)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000027952
AA Change: D331N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: D331N

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125381

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 123 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,210,149	C656S	probably benign	Het
4931408C20Rik	T	C	1: 26,685,854	R82G	probably benign	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
A2ml1	T	A	6: 128,576,260	N178I	probably damaging	Het
Acvr2b	A	G	9: 119,432,808	R437G	probably damaging	Het
Adamtsl3	C	A	7: 82,578,594	A1329E	probably damaging	Het
Adgrl2	T	C	3: 148,890,488	I71V	probably damaging	Het
Adra1a	A	T	14: 66,727,532	I324F	possibly damaging	Het
Akap13	G	T	7: 75,611,434	A1269S	probably benign	Het
Ampd1	G	T	3: 103,094,878		probably null	Het
Ankrd16	T	A	2: 11,783,695	D211E	probably damaging	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Apc	C	A	18: 34,312,045	Q665K	possibly damaging	Het
Arap2	T	C	5: 62,677,958	N747S	probably damaging	Het
Arsk	A	T	13: 76,091,812	C47*	probably null	Het
Atp8b5	T	A	4: 43,370,726	F1001I	probably benign	Het
Bap1	T	A	14: 31,258,331	Y645*	probably null	Het
Brca2	A	G	5: 150,557,129	Y2760C	probably damaging	Het
Cad	T	A	5: 31,058,072	F76I	probably damaging	Het
Capn9	G	A	8: 124,605,711	G430R	possibly damaging	Het
Ccdc27	TTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTC	4: 154,036,306		probably benign	Het
Cdkn2c	A	C	4: 109,665,063	N28K	probably null	Het
Celsr1	T	A	15: 85,963,223	I1438F	probably benign	Het
Cfhr2	T	G	1: 139,831,155	R52S	probably benign	Het
Cldn1	G	C	16: 26,371,550	A26G	probably damaging	Het
Col20a1	T	A	2: 180,992,573	F110L	probably damaging	Het
Creg2	T	C	1: 39,624,978	N204S	probably benign	Het
Cx3cl1	C	A	8: 94,779,573	Q69K	probably benign	Het
Cyfip2	T	C	11: 46,286,131	E74G	possibly damaging	Het
Cyp2g1	A	T	7: 26,820,710	I456F	probably damaging	Het
Dapk1	A	G	13: 60,729,531	E528G	possibly damaging	Het
Dapk1	T	A	13: 60,761,667	W1365R	possibly damaging	Het
Dbt	T	A	3: 116,539,124	D16E	probably damaging	Het
Depdc5	T	A	5: 32,990,781	L1469*	probably null	Het
Dnah3	T	A	7: 119,967,759	T2415S	possibly damaging	Het
Dnmbp	A	G	19: 43,854,311	L1210S	probably damaging	Het
Dpyd	T	C	3: 118,674,568	V77A	probably benign	Het
Eps15l1	A	T	8: 72,386,868	V260D	probably benign	Het
Eya1	A	G	1: 14,170,974	V573A	probably benign	Het
Fam171b	T	A	2: 83,879,858	S625T	probably damaging	Het
Fam186a	T	C	15: 99,933,676		probably benign	Het
Fam208a	A	G	14: 27,476,614	N1301S	possibly damaging	Het
Gabra4	G	T	5: 71,641,224	D137E	probably benign	Het
Gatsl2	G	A	5: 134,136,153	C187Y	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Gm43302	T	C	5: 105,274,744	D474G	probably damaging	Het
Golim4	A	T	3: 75,908,149	V116D	probably damaging	Het
Gpr19	T	C	6: 134,870,442	M1V	probably null	Het
Hnf4a	T	A	2: 163,547,418	N29K	probably benign	Het
Htt	A	G	5: 34,877,109	R1975G	possibly damaging	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Il4i1	G	A	7: 44,840,070	V420M	probably damaging	Het
Insrr	G	A	3: 87,810,572		probably null	Het
Ipo9	ATCCTCCTCCTCCTCCTC	ATCCTCCTCCTCCTCCTCCTC	1: 135,386,268		probably benign	Het
Ipo9	A	G	1: 135,402,250	V484A	probably benign	Het
Jmjd4	A	T	11: 59,454,955	H287L	probably damaging	Het
Kcnj13	A	G	1: 87,386,534	V322A	probably benign	Het
Kdm5d	T	C	Y: 941,483	L1228P	probably benign	Het
Klra3	A	G	6: 130,335,775	S9P	probably benign	Het
Ldhd	C	T	8: 111,628,537		probably null	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lmo7	A	T	14: 101,900,238	D670V	probably damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Lrp5	T	C	19: 3,622,708	T534A	possibly damaging	Het
Lrrc24	A	T	15: 76,715,581	F453I	possibly damaging	Het
Magel2	A	T	7: 62,377,738	H130L	unknown	Het
Mcpt8	T	C	14: 56,082,283	I237V	probably damaging	Het
Med4	A	G	14: 73,517,996	N248S	possibly damaging	Het
Mest	C	T	6: 30,745,885	L269F	probably damaging	Het
Mib2	C	T	4: 155,655,238		probably null	Het
Mki67	T	A	7: 135,704,241		probably null	Het
Mnx1	T	A	5: 29,474,189	S299C	unknown	Het
Nbr1	T	A	11: 101,566,191		probably null	Het
Ncapd3	T	G	9: 27,083,346	V1174G	probably damaging	Het
Nyap1	A	C	5: 137,733,681		probably null	Het
Olfml3	T	A	3: 103,735,869	M399L	probably benign	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr775	T	C	10: 129,251,074	F180S	probably benign	Het
Oosp1	T	C	19: 11,690,950	D23G	probably damaging	Het
Optc	A	T	1: 133,903,796		probably null	Het
Osbpl6	T	A	2: 76,586,214	I546K	probably damaging	Het
Otog	A	T	7: 46,250,100	N275I	probably damaging	Het
Pcdhb14	C	A	18: 37,447,870	Q10K	probably benign	Het
Pcx	T	C	19: 4,602,551	F189L	probably benign	Het
Pde6b	A	G	5: 108,428,203	D718G	probably damaging	Het
Pklr	C	A	3: 89,142,660	P314Q	probably damaging	Het
Plcb1	T	A	2: 135,325,667	Y460*	probably null	Het
Plekha6	C	A	1: 133,279,365		probably null	Het
Plekho1	A	G	3: 95,989,117	S347P	probably damaging	Het
Prelp	C	T	1: 133,915,131	R92K	probably benign	Het
Prkra	A	T	2: 76,647,136	I75K	probably damaging	Het
Ptpn11	G	A	5: 121,172,026	A31V	probably damaging	Het
Pzp	T	C	6: 128,491,161		probably null	Het
Rbm12	A	T	2: 156,095,510	C947*	probably null	Het
Ren1	C	G	1: 133,350,778		probably null	Het
Sarm1	A	T	11: 78,475,307	C649S	probably benign	Het
Sept12	T	A	16: 4,991,779	Q223L	probably damaging	Het
Sept4	A	T	11: 87,583,436	Q60L	probably benign	Het
Slc22a21	A	T	11: 53,979,733	L42Q	probably damaging	Het
Slc44a1	GCCC	GCCCCCCC	4: 53,563,246		probably null	Het
Slc9a4	T	G	1: 40,607,741		probably null	Het
Sort1	T	A	3: 108,351,686	F678Y	probably benign	Het
Spag6	T	A	2: 18,733,097	C259*	probably null	Het
Stard13	T	C	5: 151,045,168	Y879C	probably damaging	Het
Stk24	A	T	14: 121,302,211	I191N	probably damaging	Het
Tacc1	A	T	8: 25,164,493	N271K	probably damaging	Het
Tacc2	T	A	7: 130,621,857	S91T	possibly damaging	Het
Tacr3	T	C	3: 134,932,180	V366A	probably benign	Het
Tbccd1	A	G	16: 22,841,989	S26P	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tor1aip2	A	G	1: 156,065,349	Y467C	probably damaging	Het
Trove2	T	C	1: 143,760,034	D458G	probably benign	Het
Ttc9b	T	A	7: 27,654,349		probably null	Het
Tti1	T	C	2: 158,000,743	R789G	probably benign	Het
Ttn	A	T	2: 76,832,217		probably null	Het
Txk	T	A	5: 72,696,579	T472S	probably damaging	Het
Ube2cbp	A	T	9: 86,372,487		probably null	Het
Vav2	C	A	2: 27,299,396	R176L	possibly damaging	Het
Wdr27	T	A	17: 14,928,332	D133V	probably damaging	Het
Zc3h7a	A	T	16: 11,150,605	Y503*	probably null	Het
Zdhhc13	T	A	7: 48,824,644	L548Q	possibly damaging	Het
Zfp467	A	C	6: 48,442,661	S38A	probably damaging	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CAGCTGGAGACCTCTTCTATACC -3'
(R):5'- AGCACATGGTGTTTCCTTACC -3'

Sequencing Primer
(F):5'- CTCAAGAATTGTGCGTCTCTGCAAG -3'
(R):5'- GCACATCCTTTCCCAGCAG -3'

Posted On

2014-09-17