Incidental Mutation 'R2131:Insrr'
ID 228039
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
MMRRC Submission 040134-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.285) question?
Stock # R2131 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 87704258-87723408 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 87717879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably null
Transcript: ENSMUST00000029711
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107582
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Acvr2b A G 9: 119,261,874 (GRCm39) R437G probably damaging Het
Adamtsl3 C A 7: 82,227,802 (GRCm39) A1329E probably damaging Het
Adgrl2 T C 3: 148,596,124 (GRCm39) I71V probably damaging Het
Adra1a A T 14: 66,964,981 (GRCm39) I324F possibly damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Ampd1 G T 3: 103,002,194 (GRCm39) probably null Het
Ankrd16 T A 2: 11,788,506 (GRCm39) D211E probably damaging Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Apc C A 18: 34,445,098 (GRCm39) Q665K possibly damaging Het
Arap2 T C 5: 62,835,301 (GRCm39) N747S probably damaging Het
Arsk A T 13: 76,239,931 (GRCm39) C47* probably null Het
Atp8b5 T A 4: 43,370,726 (GRCm39) F1001I probably benign Het
Bap1 T A 14: 30,980,288 (GRCm39) Y645* probably null Het
Brca2 A G 5: 150,480,594 (GRCm39) Y2760C probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Castor2 G A 5: 134,164,992 (GRCm39) C187Y probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,120,763 (GRCm39) probably benign Het
Cdkn2c A C 4: 109,522,260 (GRCm39) N28K probably null Het
Celsr1 T A 15: 85,847,424 (GRCm39) I1438F probably benign Het
Cfhr2 T G 1: 139,758,893 (GRCm39) R52S probably benign Het
Cldn1 G C 16: 26,190,300 (GRCm39) A26G probably damaging Het
Col20a1 T A 2: 180,634,366 (GRCm39) F110L probably damaging Het
Creg2 T C 1: 39,664,146 (GRCm39) N204S probably benign Het
Cx3cl1 C A 8: 95,506,201 (GRCm39) Q69K probably benign Het
Cyfip2 T C 11: 46,176,958 (GRCm39) E74G possibly damaging Het
Cyp2g1 A T 7: 26,520,135 (GRCm39) I456F probably damaging Het
Dapk1 A G 13: 60,877,345 (GRCm39) E528G possibly damaging Het
Dapk1 T A 13: 60,909,481 (GRCm39) W1365R possibly damaging Het
Dbt T A 3: 116,332,773 (GRCm39) D16E probably damaging Het
Depdc5 T A 5: 33,148,125 (GRCm39) L1469* probably null Het
Dnah3 T A 7: 119,566,982 (GRCm39) T2415S possibly damaging Het
Dnmbp A G 19: 43,842,750 (GRCm39) L1210S probably damaging Het
Dpyd T C 3: 118,468,217 (GRCm39) V77A probably benign Het
Eps15l1 A T 8: 73,140,712 (GRCm39) V260D probably benign Het
Eya1 A G 1: 14,241,198 (GRCm39) V573A probably benign Het
Fam171b T A 2: 83,710,202 (GRCm39) S625T probably damaging Het
Fam186a T C 15: 99,831,557 (GRCm39) probably benign Het
Gabra4 G T 5: 71,798,567 (GRCm39) D137E probably benign Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm43302 T C 5: 105,422,610 (GRCm39) D474G probably damaging Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gpr19 T C 6: 134,847,405 (GRCm39) M1V probably null Het
Hnf4a T A 2: 163,389,338 (GRCm39) N29K probably benign Het
Htt A G 5: 35,034,453 (GRCm39) R1975G possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Il4i1 G A 7: 44,489,494 (GRCm39) V420M probably damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Jmjd4 A T 11: 59,345,781 (GRCm39) H287L probably damaging Het
Kcnj13 A G 1: 87,314,256 (GRCm39) V322A probably benign Het
Kdm5d T C Y: 941,483 (GRCm39) L1228P probably benign Het
Klra3 A G 6: 130,312,738 (GRCm39) S9P probably benign Het
Ldhd C T 8: 112,355,169 (GRCm39) probably null Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lmo7 A T 14: 102,137,674 (GRCm39) D670V probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lrp5 T C 19: 3,672,708 (GRCm39) T534A possibly damaging Het
Lrrc24 A T 15: 76,599,781 (GRCm39) F453I possibly damaging Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mcpt8 T C 14: 56,319,740 (GRCm39) I237V probably damaging Het
Med4 A G 14: 73,755,436 (GRCm39) N248S possibly damaging Het
Mest C T 6: 30,745,884 (GRCm39) L269F probably damaging Het
Mib2 C T 4: 155,739,695 (GRCm39) probably null Het
Mki67 T A 7: 135,305,970 (GRCm39) probably null Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Nbr1 T A 11: 101,457,017 (GRCm39) probably null Het
Ncapd3 T G 9: 26,994,642 (GRCm39) V1174G probably damaging Het
Nyap1 A C 5: 137,731,943 (GRCm39) probably null Het
Olfml3 T A 3: 103,643,185 (GRCm39) M399L probably benign Het
Oosp1 T C 19: 11,668,314 (GRCm39) D23G probably damaging Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or6c205 T C 10: 129,086,943 (GRCm39) F180S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Otog A T 7: 45,899,524 (GRCm39) N275I probably damaging Het
Pcdhb14 C A 18: 37,580,923 (GRCm39) Q10K probably benign Het
Pcx T C 19: 4,652,579 (GRCm39) F189L probably benign Het
Pde6b A G 5: 108,576,069 (GRCm39) D718G probably damaging Het
Pklr C A 3: 89,049,967 (GRCm39) P314Q probably damaging Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Plekho1 A G 3: 95,896,429 (GRCm39) S347P probably damaging Het
Plxna2 G A 1: 194,327,058 (GRCm39) D331N probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Prkra A T 2: 76,477,480 (GRCm39) I75K probably damaging Het
Ptpn11 G A 5: 121,310,089 (GRCm39) A31V probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Rbm12 A T 2: 155,937,430 (GRCm39) C947* probably null Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Sarm1 A T 11: 78,366,133 (GRCm39) C649S probably benign Het
Septin12 T A 16: 4,809,643 (GRCm39) Q223L probably damaging Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc22a21 A T 11: 53,870,559 (GRCm39) L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 (GRCm39) probably null Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Sort1 T A 3: 108,259,002 (GRCm39) F678Y probably benign Het
Spag6 T A 2: 18,737,908 (GRCm39) C259* probably null Het
Spata31e2 T C 1: 26,724,935 (GRCm39) R82G probably benign Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Stk24 A T 14: 121,539,623 (GRCm39) I191N probably damaging Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tacc2 T A 7: 130,223,587 (GRCm39) S91T possibly damaging Het
Tacr3 T C 3: 134,637,941 (GRCm39) V366A probably benign Het
Tasor A G 14: 27,198,571 (GRCm39) N1301S possibly damaging Het
Tbccd1 A G 16: 22,660,739 (GRCm39) S26P probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tor1aip2 A G 1: 155,941,095 (GRCm39) Y467C probably damaging Het
Ttc9b T A 7: 27,353,774 (GRCm39) probably null Het
Tti1 T C 2: 157,842,663 (GRCm39) R789G probably benign Het
Ttn A T 2: 76,662,561 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ube3d A T 9: 86,254,540 (GRCm39) probably null Het
Vav2 C A 2: 27,189,408 (GRCm39) R176L possibly damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Wdr27 T A 17: 15,148,594 (GRCm39) D133V probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp467 A C 6: 48,419,595 (GRCm39) S38A probably damaging Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87,720,981 (GRCm39) critical splice donor site probably null
IGL00801:Insrr APN 3 87,721,115 (GRCm39) missense probably damaging 1.00
IGL01628:Insrr APN 3 87,708,099 (GRCm39) nonsense probably null
IGL01755:Insrr APN 3 87,721,493 (GRCm39) missense probably damaging 1.00
IGL02100:Insrr APN 3 87,718,927 (GRCm39) missense probably damaging 1.00
IGL02261:Insrr APN 3 87,708,029 (GRCm39) missense probably damaging 1.00
IGL02366:Insrr APN 3 87,717,216 (GRCm39) missense possibly damaging 0.91
IGL02387:Insrr APN 3 87,720,434 (GRCm39) missense probably damaging 1.00
IGL02478:Insrr APN 3 87,716,719 (GRCm39) missense probably benign 0.14
IGL02550:Insrr APN 3 87,711,805 (GRCm39) missense probably damaging 1.00
IGL02555:Insrr APN 3 87,721,124 (GRCm39) missense probably damaging 0.99
IGL02673:Insrr APN 3 87,720,368 (GRCm39) missense possibly damaging 0.95
IGL02724:Insrr APN 3 87,716,879 (GRCm39) missense probably benign 0.31
IGL02798:Insrr APN 3 87,717,824 (GRCm39) missense probably damaging 1.00
IGL02969:Insrr APN 3 87,721,498 (GRCm39) nonsense probably null
IGL03073:Insrr APN 3 87,717,245 (GRCm39) splice site probably benign
IGL03178:Insrr APN 3 87,709,848 (GRCm39) splice site probably null
IGL03389:Insrr APN 3 87,716,038 (GRCm39) missense probably damaging 1.00
IGL03399:Insrr APN 3 87,716,638 (GRCm39) missense probably null 0.99
IGL02799:Insrr UTSW 3 87,720,888 (GRCm39) missense probably damaging 1.00
R0011:Insrr UTSW 3 87,716,923 (GRCm39) missense possibly damaging 0.86
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0357:Insrr UTSW 3 87,715,953 (GRCm39) splice site probably null
R0501:Insrr UTSW 3 87,717,991 (GRCm39) missense probably benign 0.12
R0504:Insrr UTSW 3 87,720,463 (GRCm39) missense possibly damaging 0.69
R0522:Insrr UTSW 3 87,708,179 (GRCm39) missense probably damaging 1.00
R0555:Insrr UTSW 3 87,721,744 (GRCm39) splice site probably benign
R0558:Insrr UTSW 3 87,718,288 (GRCm39) missense possibly damaging 0.77
R0599:Insrr UTSW 3 87,720,440 (GRCm39) missense probably damaging 0.97
R1312:Insrr UTSW 3 87,707,797 (GRCm39) missense probably damaging 1.00
R1694:Insrr UTSW 3 87,711,369 (GRCm39) missense probably benign
R1785:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1786:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1892:Insrr UTSW 3 87,721,184 (GRCm39) missense probably damaging 1.00
R1950:Insrr UTSW 3 87,721,820 (GRCm39) missense probably damaging 1.00
R2080:Insrr UTSW 3 87,721,598 (GRCm39) missense possibly damaging 0.79
R2094:Insrr UTSW 3 87,710,488 (GRCm39) missense probably damaging 1.00
R2130:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2133:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2220:Insrr UTSW 3 87,716,725 (GRCm39) missense probably damaging 1.00
R2259:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R2404:Insrr UTSW 3 87,709,974 (GRCm39) missense possibly damaging 0.71
R4027:Insrr UTSW 3 87,716,906 (GRCm39) missense probably benign
R4042:Insrr UTSW 3 87,721,134 (GRCm39) missense probably damaging 1.00
R4510:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4511:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4571:Insrr UTSW 3 87,708,194 (GRCm39) missense probably benign
R4870:Insrr UTSW 3 87,718,911 (GRCm39) missense probably damaging 1.00
R5057:Insrr UTSW 3 87,722,572 (GRCm39) missense probably benign 0.00
R5393:Insrr UTSW 3 87,718,007 (GRCm39) splice site probably null
R5685:Insrr UTSW 3 87,707,803 (GRCm39) splice site probably null
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6047:Insrr UTSW 3 87,711,483 (GRCm39) missense probably damaging 1.00
R6276:Insrr UTSW 3 87,707,826 (GRCm39) nonsense probably null
R6298:Insrr UTSW 3 87,720,272 (GRCm39) missense probably damaging 1.00
R6726:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6727:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6728:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6796:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R7041:Insrr UTSW 3 87,722,551 (GRCm39) missense probably damaging 1.00
R7169:Insrr UTSW 3 87,715,901 (GRCm39) missense probably benign 0.15
R7270:Insrr UTSW 3 87,710,440 (GRCm39) missense probably damaging 1.00
R7340:Insrr UTSW 3 87,721,623 (GRCm39) critical splice donor site probably null
R7398:Insrr UTSW 3 87,716,039 (GRCm39) missense probably damaging 1.00
R7473:Insrr UTSW 3 87,711,838 (GRCm39) splice site probably null
R7815:Insrr UTSW 3 87,716,002 (GRCm39) missense probably damaging 0.98
R8159:Insrr UTSW 3 87,707,735 (GRCm39) missense probably damaging 1.00
R8289:Insrr UTSW 3 87,721,501 (GRCm39) missense probably damaging 1.00
R8309:Insrr UTSW 3 87,717,749 (GRCm39) missense probably benign 0.00
R8312:Insrr UTSW 3 87,707,791 (GRCm39) missense possibly damaging 0.93
R8445:Insrr UTSW 3 87,720,891 (GRCm39) missense probably damaging 1.00
R8917:Insrr UTSW 3 87,718,276 (GRCm39) missense probably benign 0.00
R8960:Insrr UTSW 3 87,720,386 (GRCm39) missense probably damaging 1.00
R8989:Insrr UTSW 3 87,722,664 (GRCm39) missense probably damaging 0.96
R9015:Insrr UTSW 3 87,720,910 (GRCm39) missense probably damaging 1.00
R9202:Insrr UTSW 3 87,720,427 (GRCm39) missense probably damaging 1.00
R9251:Insrr UTSW 3 87,717,391 (GRCm39) missense probably benign 0.08
R9327:Insrr UTSW 3 87,721,604 (GRCm39) missense probably damaging 1.00
R9646:Insrr UTSW 3 87,721,805 (GRCm39) missense probably damaging 1.00
RF022:Insrr UTSW 3 87,711,792 (GRCm39) missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87,708,134 (GRCm39) missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87,709,886 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCTTGTGGCCTATTTGC -3'
(R):5'- GTAACACCGTCAGTCCAGGAAC -3'

Sequencing Primer
(F):5'- GCCTATTTGCCAGACGCC -3'
(R):5'- GTCAGTCCAGGAACCATTGC -3'
Posted On 2014-09-17