Incidental Mutation 'R2131:Cyp2g1'
ID 228079
Institutional Source Beutler Lab
Gene Symbol Cyp2g1
Ensembl Gene ENSMUSG00000049685
Gene Name cytochrome P450, family 2, subfamily g, polypeptide 1
Synonyms
MMRRC Submission 040134-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2131 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 26508352-26520622 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26520135 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 456 (I456F)
Ref Sequence ENSEMBL: ENSMUSP00000047150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040944]
AlphaFold Q9WV19
Predicted Effect probably damaging
Transcript: ENSMUST00000040944
AA Change: I456F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685
AA Change: I456F

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205273
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Acvr2b A G 9: 119,261,874 (GRCm39) R437G probably damaging Het
Adamtsl3 C A 7: 82,227,802 (GRCm39) A1329E probably damaging Het
Adgrl2 T C 3: 148,596,124 (GRCm39) I71V probably damaging Het
Adra1a A T 14: 66,964,981 (GRCm39) I324F possibly damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Ampd1 G T 3: 103,002,194 (GRCm39) probably null Het
Ankrd16 T A 2: 11,788,506 (GRCm39) D211E probably damaging Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Apc C A 18: 34,445,098 (GRCm39) Q665K possibly damaging Het
Arap2 T C 5: 62,835,301 (GRCm39) N747S probably damaging Het
Arsk A T 13: 76,239,931 (GRCm39) C47* probably null Het
Atp8b5 T A 4: 43,370,726 (GRCm39) F1001I probably benign Het
Bap1 T A 14: 30,980,288 (GRCm39) Y645* probably null Het
Brca2 A G 5: 150,480,594 (GRCm39) Y2760C probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Castor2 G A 5: 134,164,992 (GRCm39) C187Y probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,120,763 (GRCm39) probably benign Het
Cdkn2c A C 4: 109,522,260 (GRCm39) N28K probably null Het
Celsr1 T A 15: 85,847,424 (GRCm39) I1438F probably benign Het
Cfhr2 T G 1: 139,758,893 (GRCm39) R52S probably benign Het
Cldn1 G C 16: 26,190,300 (GRCm39) A26G probably damaging Het
Col20a1 T A 2: 180,634,366 (GRCm39) F110L probably damaging Het
Creg2 T C 1: 39,664,146 (GRCm39) N204S probably benign Het
Cx3cl1 C A 8: 95,506,201 (GRCm39) Q69K probably benign Het
Cyfip2 T C 11: 46,176,958 (GRCm39) E74G possibly damaging Het
Dapk1 A G 13: 60,877,345 (GRCm39) E528G possibly damaging Het
Dapk1 T A 13: 60,909,481 (GRCm39) W1365R possibly damaging Het
Dbt T A 3: 116,332,773 (GRCm39) D16E probably damaging Het
Depdc5 T A 5: 33,148,125 (GRCm39) L1469* probably null Het
Dnah3 T A 7: 119,566,982 (GRCm39) T2415S possibly damaging Het
Dnmbp A G 19: 43,842,750 (GRCm39) L1210S probably damaging Het
Dpyd T C 3: 118,468,217 (GRCm39) V77A probably benign Het
Eps15l1 A T 8: 73,140,712 (GRCm39) V260D probably benign Het
Eya1 A G 1: 14,241,198 (GRCm39) V573A probably benign Het
Fam171b T A 2: 83,710,202 (GRCm39) S625T probably damaging Het
Fam186a T C 15: 99,831,557 (GRCm39) probably benign Het
Gabra4 G T 5: 71,798,567 (GRCm39) D137E probably benign Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm43302 T C 5: 105,422,610 (GRCm39) D474G probably damaging Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gpr19 T C 6: 134,847,405 (GRCm39) M1V probably null Het
Hnf4a T A 2: 163,389,338 (GRCm39) N29K probably benign Het
Htt A G 5: 35,034,453 (GRCm39) R1975G possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Il4i1 G A 7: 44,489,494 (GRCm39) V420M probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Jmjd4 A T 11: 59,345,781 (GRCm39) H287L probably damaging Het
Kcnj13 A G 1: 87,314,256 (GRCm39) V322A probably benign Het
Kdm5d T C Y: 941,483 (GRCm39) L1228P probably benign Het
Klra3 A G 6: 130,312,738 (GRCm39) S9P probably benign Het
Ldhd C T 8: 112,355,169 (GRCm39) probably null Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lmo7 A T 14: 102,137,674 (GRCm39) D670V probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lrp5 T C 19: 3,672,708 (GRCm39) T534A possibly damaging Het
Lrrc24 A T 15: 76,599,781 (GRCm39) F453I possibly damaging Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mcpt8 T C 14: 56,319,740 (GRCm39) I237V probably damaging Het
Med4 A G 14: 73,755,436 (GRCm39) N248S possibly damaging Het
Mest C T 6: 30,745,884 (GRCm39) L269F probably damaging Het
Mib2 C T 4: 155,739,695 (GRCm39) probably null Het
Mki67 T A 7: 135,305,970 (GRCm39) probably null Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Nbr1 T A 11: 101,457,017 (GRCm39) probably null Het
Ncapd3 T G 9: 26,994,642 (GRCm39) V1174G probably damaging Het
Nyap1 A C 5: 137,731,943 (GRCm39) probably null Het
Olfml3 T A 3: 103,643,185 (GRCm39) M399L probably benign Het
Oosp1 T C 19: 11,668,314 (GRCm39) D23G probably damaging Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or6c205 T C 10: 129,086,943 (GRCm39) F180S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Otog A T 7: 45,899,524 (GRCm39) N275I probably damaging Het
Pcdhb14 C A 18: 37,580,923 (GRCm39) Q10K probably benign Het
Pcx T C 19: 4,652,579 (GRCm39) F189L probably benign Het
Pde6b A G 5: 108,576,069 (GRCm39) D718G probably damaging Het
Pklr C A 3: 89,049,967 (GRCm39) P314Q probably damaging Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Plekho1 A G 3: 95,896,429 (GRCm39) S347P probably damaging Het
Plxna2 G A 1: 194,327,058 (GRCm39) D331N probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Prkra A T 2: 76,477,480 (GRCm39) I75K probably damaging Het
Ptpn11 G A 5: 121,310,089 (GRCm39) A31V probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Rbm12 A T 2: 155,937,430 (GRCm39) C947* probably null Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Sarm1 A T 11: 78,366,133 (GRCm39) C649S probably benign Het
Septin12 T A 16: 4,809,643 (GRCm39) Q223L probably damaging Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc22a21 A T 11: 53,870,559 (GRCm39) L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 (GRCm39) probably null Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Sort1 T A 3: 108,259,002 (GRCm39) F678Y probably benign Het
Spag6 T A 2: 18,737,908 (GRCm39) C259* probably null Het
Spata31e2 T C 1: 26,724,935 (GRCm39) R82G probably benign Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Stk24 A T 14: 121,539,623 (GRCm39) I191N probably damaging Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tacc2 T A 7: 130,223,587 (GRCm39) S91T possibly damaging Het
Tacr3 T C 3: 134,637,941 (GRCm39) V366A probably benign Het
Tasor A G 14: 27,198,571 (GRCm39) N1301S possibly damaging Het
Tbccd1 A G 16: 22,660,739 (GRCm39) S26P probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tor1aip2 A G 1: 155,941,095 (GRCm39) Y467C probably damaging Het
Ttc9b T A 7: 27,353,774 (GRCm39) probably null Het
Tti1 T C 2: 157,842,663 (GRCm39) R789G probably benign Het
Ttn A T 2: 76,662,561 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ube3d A T 9: 86,254,540 (GRCm39) probably null Het
Vav2 C A 2: 27,189,408 (GRCm39) R176L possibly damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Wdr27 T A 17: 15,148,594 (GRCm39) D133V probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp467 A C 6: 48,419,595 (GRCm39) S38A probably damaging Het
Other mutations in Cyp2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2g1 APN 7 26,509,256 (GRCm39) missense probably benign 0.05
IGL01137:Cyp2g1 APN 7 26,513,684 (GRCm39) missense possibly damaging 0.87
IGL02052:Cyp2g1 APN 7 26,513,719 (GRCm39) splice site probably benign
IGL02338:Cyp2g1 APN 7 26,514,229 (GRCm39) splice site probably benign
IGL02452:Cyp2g1 APN 7 26,510,871 (GRCm39) missense probably benign 0.28
IGL02523:Cyp2g1 APN 7 26,518,612 (GRCm39) missense probably damaging 1.00
IGL03165:Cyp2g1 APN 7 26,509,201 (GRCm39) missense possibly damaging 0.94
IGL03230:Cyp2g1 APN 7 26,518,828 (GRCm39) missense probably damaging 1.00
PIT4472001:Cyp2g1 UTSW 7 26,513,619 (GRCm39) missense probably benign 0.28
R0106:Cyp2g1 UTSW 7 26,513,607 (GRCm39) missense probably damaging 1.00
R0106:Cyp2g1 UTSW 7 26,513,607 (GRCm39) missense probably damaging 1.00
R0380:Cyp2g1 UTSW 7 26,513,720 (GRCm39) splice site probably benign
R0697:Cyp2g1 UTSW 7 26,514,152 (GRCm39) nonsense probably null
R0830:Cyp2g1 UTSW 7 26,514,216 (GRCm39) missense probably benign 0.00
R1660:Cyp2g1 UTSW 7 26,509,107 (GRCm39) critical splice acceptor site probably null
R2093:Cyp2g1 UTSW 7 26,518,858 (GRCm39) missense probably benign 0.35
R4606:Cyp2g1 UTSW 7 26,513,579 (GRCm39) missense possibly damaging 0.80
R5030:Cyp2g1 UTSW 7 26,520,226 (GRCm39) missense probably benign 0.06
R5574:Cyp2g1 UTSW 7 26,520,165 (GRCm39) missense possibly damaging 0.81
R5877:Cyp2g1 UTSW 7 26,516,065 (GRCm39) missense possibly damaging 0.80
R6745:Cyp2g1 UTSW 7 26,513,604 (GRCm39) missense probably damaging 1.00
R7040:Cyp2g1 UTSW 7 26,520,184 (GRCm39) missense probably damaging 0.99
R7223:Cyp2g1 UTSW 7 26,514,057 (GRCm39) missense probably damaging 0.98
R7934:Cyp2g1 UTSW 7 26,518,618 (GRCm39) missense probably damaging 1.00
R8112:Cyp2g1 UTSW 7 26,518,886 (GRCm39) missense probably benign
R8177:Cyp2g1 UTSW 7 26,518,578 (GRCm39) missense probably damaging 1.00
R8194:Cyp2g1 UTSW 7 26,514,159 (GRCm39) missense possibly damaging 0.89
R9043:Cyp2g1 UTSW 7 26,509,256 (GRCm39) missense probably benign 0.05
R9406:Cyp2g1 UTSW 7 26,518,910 (GRCm39) critical splice donor site probably null
R9441:Cyp2g1 UTSW 7 26,514,060 (GRCm39) missense possibly damaging 0.72
X0067:Cyp2g1 UTSW 7 26,520,187 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TCTAAGGGACAGGTATCAGTGG -3'
(R):5'- GTGTGTGAACTTCAGCAGAGC -3'

Sequencing Primer
(F):5'- ACAGGTATCAGTGGGACCC -3'
(R):5'- GTGAACTTCAGCAGAGCTCAGC -3'
Posted On 2014-09-17