Incidental Mutation 'R2131:Magel2'
ID228084
Institutional Source Beutler Lab
Gene Symbol Magel2
Ensembl Gene ENSMUSG00000056972
Gene Namemelanoma antigen, family L, 2
SynonymsnM15, ns7, NDNL1, Mage-l2
MMRRC Submission 040134-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2131 (G1)
Quality Score200
Status Not validated
Chromosome7
Chromosomal Location62377010-62381640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62377738 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 130 (H130L)
Ref Sequence ENSEMBL: ENSMUSP00000079265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080403]
Predicted Effect unknown
Transcript: ENSMUST00000080403
AA Change: H130L
SMART Domains Protein: ENSMUSP00000079265
Gene: ENSMUSG00000056972
AA Change: H130L

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 51 84 N/A INTRINSIC
internal_repeat_1 85 131 2.45e-10 PROSPERO
low complexity region 134 205 N/A INTRINSIC
internal_repeat_1 222 298 2.45e-10 PROSPERO
internal_repeat_2 289 332 6.32e-5 PROSPERO
low complexity region 347 363 N/A INTRINSIC
low complexity region 467 492 N/A INTRINSIC
internal_repeat_2 494 535 6.32e-5 PROSPERO
low complexity region 560 648 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 761 785 N/A INTRINSIC
low complexity region 903 920 N/A INTRINSIC
MAGE 1059 1229 6.82e-65 SMART
low complexity region 1262 1284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice heterozygous for a null allele that is inherited paternally exhibit some postnatal lethality, reduced male fertility, abnormal circadian rhythm, and hypoactivity. Mice heterozygous for another paternal knock-out allele exhibit 50% neonatal lethalityassociated with weak suckling activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
4931408C20Rik T C 1: 26,685,854 R82G probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Acvr2b A G 9: 119,432,808 R437G probably damaging Het
Adamtsl3 C A 7: 82,578,594 A1329E probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adra1a A T 14: 66,727,532 I324F possibly damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Ampd1 G T 3: 103,094,878 probably null Het
Ankrd16 T A 2: 11,783,695 D211E probably damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Arap2 T C 5: 62,677,958 N747S probably damaging Het
Arsk A T 13: 76,091,812 C47* probably null Het
Atp8b5 T A 4: 43,370,726 F1001I probably benign Het
Bap1 T A 14: 31,258,331 Y645* probably null Het
Brca2 A G 5: 150,557,129 Y2760C probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Cdkn2c A C 4: 109,665,063 N28K probably null Het
Celsr1 T A 15: 85,963,223 I1438F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Cldn1 G C 16: 26,371,550 A26G probably damaging Het
Col20a1 T A 2: 180,992,573 F110L probably damaging Het
Creg2 T C 1: 39,624,978 N204S probably benign Het
Cx3cl1 C A 8: 94,779,573 Q69K probably benign Het
Cyfip2 T C 11: 46,286,131 E74G possibly damaging Het
Cyp2g1 A T 7: 26,820,710 I456F probably damaging Het
Dapk1 A G 13: 60,729,531 E528G possibly damaging Het
Dapk1 T A 13: 60,761,667 W1365R possibly damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Depdc5 T A 5: 32,990,781 L1469* probably null Het
Dnah3 T A 7: 119,967,759 T2415S possibly damaging Het
Dnmbp A G 19: 43,854,311 L1210S probably damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Eya1 A G 1: 14,170,974 V573A probably benign Het
Fam171b T A 2: 83,879,858 S625T probably damaging Het
Fam186a T C 15: 99,933,676 probably benign Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Gabra4 G T 5: 71,641,224 D137E probably benign Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm43302 T C 5: 105,274,744 D474G probably damaging Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr19 T C 6: 134,870,442 M1V probably null Het
Hnf4a T A 2: 163,547,418 N29K probably benign Het
Htt A G 5: 34,877,109 R1975G possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Il4i1 G A 7: 44,840,070 V420M probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd4 A T 11: 59,454,955 H287L probably damaging Het
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Kdm5d T C Y: 941,483 L1228P probably benign Het
Klra3 A G 6: 130,335,775 S9P probably benign Het
Ldhd C T 8: 111,628,537 probably null Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmo7 A T 14: 101,900,238 D670V probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lrp5 T C 19: 3,622,708 T534A possibly damaging Het
Lrrc24 A T 15: 76,715,581 F453I possibly damaging Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Med4 A G 14: 73,517,996 N248S possibly damaging Het
Mest C T 6: 30,745,885 L269F probably damaging Het
Mib2 C T 4: 155,655,238 probably null Het
Mki67 T A 7: 135,704,241 probably null Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Nbr1 T A 11: 101,566,191 probably null Het
Ncapd3 T G 9: 27,083,346 V1174G probably damaging Het
Nyap1 A C 5: 137,733,681 probably null Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr775 T C 10: 129,251,074 F180S probably benign Het
Oosp1 T C 19: 11,690,950 D23G probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Otog A T 7: 46,250,100 N275I probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pcx T C 19: 4,602,551 F189L probably benign Het
Pde6b A G 5: 108,428,203 D718G probably damaging Het
Pklr C A 3: 89,142,660 P314Q probably damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Plekho1 A G 3: 95,989,117 S347P probably damaging Het
Plxna2 G A 1: 194,644,750 D331N probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prkra A T 2: 76,647,136 I75K probably damaging Het
Ptpn11 G A 5: 121,172,026 A31V probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Ren1 C G 1: 133,350,778 probably null Het
Sarm1 A T 11: 78,475,307 C649S probably benign Het
Sept12 T A 16: 4,991,779 Q223L probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc22a21 A T 11: 53,979,733 L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 probably null Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spag6 T A 2: 18,733,097 C259* probably null Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Stk24 A T 14: 121,302,211 I191N probably damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tacc2 T A 7: 130,621,857 S91T possibly damaging Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tbccd1 A G 16: 22,841,989 S26P probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tor1aip2 A G 1: 156,065,349 Y467C probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Tti1 T C 2: 158,000,743 R789G probably benign Het
Ttn A T 2: 76,832,217 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2cbp A T 9: 86,372,487 probably null Het
Vav2 C A 2: 27,299,396 R176L possibly damaging Het
Wdr27 T A 17: 14,928,332 D133V probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp467 A C 6: 48,442,661 S38A probably damaging Het
Other mutations in Magel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Magel2 APN 7 62379322 missense unknown
IGL01391:Magel2 APN 7 62380884 missense unknown
IGL01876:Magel2 APN 7 62378827 missense possibly damaging 0.68
IGL02613:Magel2 APN 7 62380198 missense unknown
IGL02617:Magel2 APN 7 62380198 missense unknown
IGL03256:Magel2 APN 7 62380414 missense unknown
IGL03382:Magel2 APN 7 62378713 missense probably benign 0.00
astroclast2 UTSW 7 62380159 missense unknown
IGL02837:Magel2 UTSW 7 62378260 missense possibly damaging 0.93
R0398:Magel2 UTSW 7 62380551 nonsense probably null
R0463:Magel2 UTSW 7 62378030 missense possibly damaging 0.53
R1033:Magel2 UTSW 7 62380050 missense unknown
R1271:Magel2 UTSW 7 62381014 missense unknown
R1518:Magel2 UTSW 7 62380440 missense unknown
R1539:Magel2 UTSW 7 62378809 missense possibly damaging 0.91
R1682:Magel2 UTSW 7 62380235 missense unknown
R1686:Magel2 UTSW 7 62378240 missense possibly damaging 0.53
R1782:Magel2 UTSW 7 62380857 nonsense probably null
R1785:Magel2 UTSW 7 62377738 missense unknown
R1786:Magel2 UTSW 7 62377738 missense unknown
R1950:Magel2 UTSW 7 62378415 missense possibly damaging 0.48
R2001:Magel2 UTSW 7 62379096 missense unknown
R2002:Magel2 UTSW 7 62379096 missense unknown
R2018:Magel2 UTSW 7 62379096 missense unknown
R2019:Magel2 UTSW 7 62379096 missense unknown
R2029:Magel2 UTSW 7 62380594 missense unknown
R2070:Magel2 UTSW 7 62379096 missense unknown
R2132:Magel2 UTSW 7 62377738 missense unknown
R2133:Magel2 UTSW 7 62377738 missense unknown
R2134:Magel2 UTSW 7 62379096 missense unknown
R2155:Magel2 UTSW 7 62380792 missense unknown
R4294:Magel2 UTSW 7 62378767 missense possibly damaging 0.86
R4591:Magel2 UTSW 7 62381089 missense unknown
R4621:Magel2 UTSW 7 62377738 missense unknown
R4816:Magel2 UTSW 7 62381092 missense unknown
R4931:Magel2 UTSW 7 62380624 missense unknown
R5031:Magel2 UTSW 7 62380104 missense unknown
R5034:Magel2 UTSW 7 62379868 missense unknown
R5042:Magel2 UTSW 7 62379606 missense unknown
R5600:Magel2 UTSW 7 62379766 missense unknown
R5769:Magel2 UTSW 7 62378113 missense probably benign 0.02
R5980:Magel2 UTSW 7 62380596 missense unknown
R5987:Magel2 UTSW 7 62378767 missense probably benign 0.33
R6187:Magel2 UTSW 7 62377641 missense unknown
R6267:Magel2 UTSW 7 62378679 missense probably damaging 0.98
R6270:Magel2 UTSW 7 62380658 nonsense probably null
R6316:Magel2 UTSW 7 62378719 missense possibly damaging 0.68
R6444:Magel2 UTSW 7 62379999 missense unknown
R6452:Magel2 UTSW 7 62380384 missense unknown
R6797:Magel2 UTSW 7 62380159 missense unknown
R6917:Magel2 UTSW 7 62377844 small deletion probably benign
R7011:Magel2 UTSW 7 62378533 missense possibly damaging 0.92
R7025:Magel2 UTSW 7 62379787 missense unknown
R7335:Magel2 UTSW 7 62380776 missense unknown
R7353:Magel2 UTSW 7 62379331 missense unknown
R7413:Magel2 UTSW 7 62377844 small deletion probably benign
R7570:Magel2 UTSW 7 62378910 missense possibly damaging 0.53
R7714:Magel2 UTSW 7 62378382 missense probably benign 0.08
RF022:Magel2 UTSW 7 62380093 missense unknown
Z1088:Magel2 UTSW 7 62378977 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCAGCTAAGTACGAATCTGGG -3'
(R):5'- AGGATGGGTCATAGGGTTCC -3'

Sequencing Primer
(F):5'- AGTGCCTGCAGTCCATAGC -3'
(R):5'- TCATAGGGTTCCCAGGAGG -3'
Posted On2014-09-17