Incidental Mutation 'R2131:Celsr1'
ID 228127
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Name cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms Scy, Adgrc1, Crsh, crash
MMRRC Submission 040134-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.634) question?
Stock # R2131 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 85783130-85918404 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85847424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1438 (I1438F)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000016172
AA Change: I1438F

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: I1438F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226840
AA Change: I71F
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Acvr2b A G 9: 119,261,874 (GRCm39) R437G probably damaging Het
Adamtsl3 C A 7: 82,227,802 (GRCm39) A1329E probably damaging Het
Adgrl2 T C 3: 148,596,124 (GRCm39) I71V probably damaging Het
Adra1a A T 14: 66,964,981 (GRCm39) I324F possibly damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Ampd1 G T 3: 103,002,194 (GRCm39) probably null Het
Ankrd16 T A 2: 11,788,506 (GRCm39) D211E probably damaging Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Apc C A 18: 34,445,098 (GRCm39) Q665K possibly damaging Het
Arap2 T C 5: 62,835,301 (GRCm39) N747S probably damaging Het
Arsk A T 13: 76,239,931 (GRCm39) C47* probably null Het
Atp8b5 T A 4: 43,370,726 (GRCm39) F1001I probably benign Het
Bap1 T A 14: 30,980,288 (GRCm39) Y645* probably null Het
Brca2 A G 5: 150,480,594 (GRCm39) Y2760C probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Castor2 G A 5: 134,164,992 (GRCm39) C187Y probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,120,763 (GRCm39) probably benign Het
Cdkn2c A C 4: 109,522,260 (GRCm39) N28K probably null Het
Cfhr2 T G 1: 139,758,893 (GRCm39) R52S probably benign Het
Cldn1 G C 16: 26,190,300 (GRCm39) A26G probably damaging Het
Col20a1 T A 2: 180,634,366 (GRCm39) F110L probably damaging Het
Creg2 T C 1: 39,664,146 (GRCm39) N204S probably benign Het
Cx3cl1 C A 8: 95,506,201 (GRCm39) Q69K probably benign Het
Cyfip2 T C 11: 46,176,958 (GRCm39) E74G possibly damaging Het
Cyp2g1 A T 7: 26,520,135 (GRCm39) I456F probably damaging Het
Dapk1 T A 13: 60,909,481 (GRCm39) W1365R possibly damaging Het
Dapk1 A G 13: 60,877,345 (GRCm39) E528G possibly damaging Het
Dbt T A 3: 116,332,773 (GRCm39) D16E probably damaging Het
Depdc5 T A 5: 33,148,125 (GRCm39) L1469* probably null Het
Dnah3 T A 7: 119,566,982 (GRCm39) T2415S possibly damaging Het
Dnmbp A G 19: 43,842,750 (GRCm39) L1210S probably damaging Het
Dpyd T C 3: 118,468,217 (GRCm39) V77A probably benign Het
Eps15l1 A T 8: 73,140,712 (GRCm39) V260D probably benign Het
Eya1 A G 1: 14,241,198 (GRCm39) V573A probably benign Het
Fam171b T A 2: 83,710,202 (GRCm39) S625T probably damaging Het
Fam186a T C 15: 99,831,557 (GRCm39) probably benign Het
Gabra4 G T 5: 71,798,567 (GRCm39) D137E probably benign Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm43302 T C 5: 105,422,610 (GRCm39) D474G probably damaging Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gpr19 T C 6: 134,847,405 (GRCm39) M1V probably null Het
Hnf4a T A 2: 163,389,338 (GRCm39) N29K probably benign Het
Htt A G 5: 35,034,453 (GRCm39) R1975G possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Il4i1 G A 7: 44,489,494 (GRCm39) V420M probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Jmjd4 A T 11: 59,345,781 (GRCm39) H287L probably damaging Het
Kcnj13 A G 1: 87,314,256 (GRCm39) V322A probably benign Het
Kdm5d T C Y: 941,483 (GRCm39) L1228P probably benign Het
Klra3 A G 6: 130,312,738 (GRCm39) S9P probably benign Het
Ldhd C T 8: 112,355,169 (GRCm39) probably null Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lmo7 A T 14: 102,137,674 (GRCm39) D670V probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lrp5 T C 19: 3,672,708 (GRCm39) T534A possibly damaging Het
Lrrc24 A T 15: 76,599,781 (GRCm39) F453I possibly damaging Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mcpt8 T C 14: 56,319,740 (GRCm39) I237V probably damaging Het
Med4 A G 14: 73,755,436 (GRCm39) N248S possibly damaging Het
Mest C T 6: 30,745,884 (GRCm39) L269F probably damaging Het
Mib2 C T 4: 155,739,695 (GRCm39) probably null Het
Mki67 T A 7: 135,305,970 (GRCm39) probably null Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Nbr1 T A 11: 101,457,017 (GRCm39) probably null Het
Ncapd3 T G 9: 26,994,642 (GRCm39) V1174G probably damaging Het
Nyap1 A C 5: 137,731,943 (GRCm39) probably null Het
Olfml3 T A 3: 103,643,185 (GRCm39) M399L probably benign Het
Oosp1 T C 19: 11,668,314 (GRCm39) D23G probably damaging Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or6c205 T C 10: 129,086,943 (GRCm39) F180S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Otog A T 7: 45,899,524 (GRCm39) N275I probably damaging Het
Pcdhb14 C A 18: 37,580,923 (GRCm39) Q10K probably benign Het
Pcx T C 19: 4,652,579 (GRCm39) F189L probably benign Het
Pde6b A G 5: 108,576,069 (GRCm39) D718G probably damaging Het
Pklr C A 3: 89,049,967 (GRCm39) P314Q probably damaging Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Plekho1 A G 3: 95,896,429 (GRCm39) S347P probably damaging Het
Plxna2 G A 1: 194,327,058 (GRCm39) D331N probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Prkra A T 2: 76,477,480 (GRCm39) I75K probably damaging Het
Ptpn11 G A 5: 121,310,089 (GRCm39) A31V probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Rbm12 A T 2: 155,937,430 (GRCm39) C947* probably null Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Sarm1 A T 11: 78,366,133 (GRCm39) C649S probably benign Het
Septin12 T A 16: 4,809,643 (GRCm39) Q223L probably damaging Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc22a21 A T 11: 53,870,559 (GRCm39) L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 (GRCm39) probably null Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Sort1 T A 3: 108,259,002 (GRCm39) F678Y probably benign Het
Spag6 T A 2: 18,737,908 (GRCm39) C259* probably null Het
Spata31e2 T C 1: 26,724,935 (GRCm39) R82G probably benign Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Stk24 A T 14: 121,539,623 (GRCm39) I191N probably damaging Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tacc2 T A 7: 130,223,587 (GRCm39) S91T possibly damaging Het
Tacr3 T C 3: 134,637,941 (GRCm39) V366A probably benign Het
Tasor A G 14: 27,198,571 (GRCm39) N1301S possibly damaging Het
Tbccd1 A G 16: 22,660,739 (GRCm39) S26P probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tor1aip2 A G 1: 155,941,095 (GRCm39) Y467C probably damaging Het
Ttc9b T A 7: 27,353,774 (GRCm39) probably null Het
Tti1 T C 2: 157,842,663 (GRCm39) R789G probably benign Het
Ttn A T 2: 76,662,561 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ube3d A T 9: 86,254,540 (GRCm39) probably null Het
Vav2 C A 2: 27,189,408 (GRCm39) R176L possibly damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Wdr27 T A 17: 15,148,594 (GRCm39) D133V probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp467 A C 6: 48,419,595 (GRCm39) S38A probably damaging Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85,815,546 (GRCm39) missense probably benign 0.04
IGL00519:Celsr1 APN 15 85,915,037 (GRCm39) missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85,806,436 (GRCm39) missense probably damaging 1.00
IGL01303:Celsr1 APN 15 85,914,692 (GRCm39) missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85,810,391 (GRCm39) missense probably benign 0.35
IGL01910:Celsr1 APN 15 85,814,096 (GRCm39) missense probably benign
IGL01931:Celsr1 APN 15 85,791,861 (GRCm39) missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85,847,424 (GRCm39) missense probably benign 0.35
IGL02090:Celsr1 APN 15 85,791,922 (GRCm39) missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85,863,205 (GRCm39) missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85,814,108 (GRCm39) missense probably benign 0.01
IGL02413:Celsr1 APN 15 85,915,427 (GRCm39) missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85,825,337 (GRCm39) missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85,784,889 (GRCm39) utr 3 prime probably benign
IGL02508:Celsr1 APN 15 85,914,818 (GRCm39) nonsense probably null
IGL02899:Celsr1 APN 15 85,915,927 (GRCm39) missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85,785,673 (GRCm39) missense probably benign
IGL03212:Celsr1 APN 15 85,814,878 (GRCm39) missense probably benign 0.04
P0028:Celsr1 UTSW 15 85,806,436 (GRCm39) missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85,785,138 (GRCm39) missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 85,916,615 (GRCm39) missense probably damaging 0.99
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85,813,620 (GRCm39) missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 85,914,963 (GRCm39) missense probably benign 0.02
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85,787,065 (GRCm39) missense probably benign 0.00
R0570:Celsr1 UTSW 15 85,787,566 (GRCm39) missense probably benign 0.18
R0611:Celsr1 UTSW 15 85,816,524 (GRCm39) missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85,785,798 (GRCm39) missense probably benign
R0792:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R0943:Celsr1 UTSW 15 85,787,489 (GRCm39) missense probably damaging 1.00
R0989:Celsr1 UTSW 15 85,915,480 (GRCm39) missense probably benign 0.39
R1118:Celsr1 UTSW 15 85,916,248 (GRCm39) missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R1239:Celsr1 UTSW 15 85,863,347 (GRCm39) missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1522:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R1662:Celsr1 UTSW 15 85,915,263 (GRCm39) missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85,816,658 (GRCm39) missense probably benign 0.00
R1795:Celsr1 UTSW 15 85,914,524 (GRCm39) missense probably damaging 0.99
R1799:Celsr1 UTSW 15 85,916,886 (GRCm39) missense probably damaging 1.00
R1858:Celsr1 UTSW 15 85,916,960 (GRCm39) missense probably damaging 1.00
R2040:Celsr1 UTSW 15 85,917,088 (GRCm39) missense probably damaging 1.00
R2050:Celsr1 UTSW 15 85,914,748 (GRCm39) missense probably benign 0.02
R2132:Celsr1 UTSW 15 85,916,168 (GRCm39) missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85,863,431 (GRCm39) missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85,800,924 (GRCm39) missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 85,916,008 (GRCm39) missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85,863,028 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,847,334 (GRCm39) missense probably benign 0.00
R4416:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85,800,957 (GRCm39) missense probably benign 0.35
R4666:Celsr1 UTSW 15 85,914,695 (GRCm39) missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85,816,661 (GRCm39) missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85,790,230 (GRCm39) critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85,822,154 (GRCm39) missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85,822,112 (GRCm39) missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85,823,335 (GRCm39) missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85,816,585 (GRCm39) missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85,814,747 (GRCm39) missense probably benign
R5310:Celsr1 UTSW 15 85,810,423 (GRCm39) missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85,815,483 (GRCm39) missense probably benign 0.00
R5639:Celsr1 UTSW 15 85,914,968 (GRCm39) missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85,825,465 (GRCm39) missense probably benign 0.27
R5778:Celsr1 UTSW 15 85,917,156 (GRCm39) missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85,788,215 (GRCm39) missense probably benign 0.02
R5915:Celsr1 UTSW 15 85,914,550 (GRCm39) missense probably damaging 0.96
R5915:Celsr1 UTSW 15 85,822,176 (GRCm39) missense probably benign
R5932:Celsr1 UTSW 15 85,916,905 (GRCm39) missense probably damaging 1.00
R5950:Celsr1 UTSW 15 85,916,701 (GRCm39) missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85,803,239 (GRCm39) splice site probably null
R6050:Celsr1 UTSW 15 85,814,812 (GRCm39) missense probably benign 0.00
R6117:Celsr1 UTSW 15 85,816,612 (GRCm39) missense probably benign 0.04
R6178:Celsr1 UTSW 15 85,785,222 (GRCm39) missense probably benign 0.08
R6186:Celsr1 UTSW 15 85,805,394 (GRCm39) missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85,800,888 (GRCm39) missense probably benign 0.25
R6307:Celsr1 UTSW 15 85,812,531 (GRCm39) missense probably benign
R6320:Celsr1 UTSW 15 85,785,160 (GRCm39) missense probably benign 0.13
R6349:Celsr1 UTSW 15 85,915,885 (GRCm39) missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85,863,121 (GRCm39) missense probably benign 0.07
R6607:Celsr1 UTSW 15 85,847,486 (GRCm39) missense probably benign
R6615:Celsr1 UTSW 15 85,786,315 (GRCm39) critical splice donor site probably null
R6661:Celsr1 UTSW 15 85,803,135 (GRCm39) missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85,790,115 (GRCm39) critical splice donor site probably null
R6743:Celsr1 UTSW 15 85,791,799 (GRCm39) missense probably damaging 0.96
R6746:Celsr1 UTSW 15 85,915,696 (GRCm39) missense probably damaging 1.00
R6772:Celsr1 UTSW 15 85,914,983 (GRCm39) missense probably benign
R6838:Celsr1 UTSW 15 85,823,395 (GRCm39) missense probably benign
R6886:Celsr1 UTSW 15 85,915,855 (GRCm39) missense probably benign 0.00
R7030:Celsr1 UTSW 15 85,789,679 (GRCm39) missense probably damaging 0.99
R7060:Celsr1 UTSW 15 85,916,856 (GRCm39) missense probably benign 0.07
R7080:Celsr1 UTSW 15 85,816,652 (GRCm39) missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 85,917,209 (GRCm39) missense probably damaging 0.99
R7357:Celsr1 UTSW 15 85,914,715 (GRCm39) missense probably benign 0.00
R7371:Celsr1 UTSW 15 85,914,875 (GRCm39) missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85,791,874 (GRCm39) missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 85,917,593 (GRCm39) missense probably benign
R7491:Celsr1 UTSW 15 85,916,719 (GRCm39) missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85,814,073 (GRCm39) missense probably benign 0.00
R7685:Celsr1 UTSW 15 85,862,933 (GRCm39) nonsense probably null
R7741:Celsr1 UTSW 15 85,863,303 (GRCm39) missense possibly damaging 0.94
R7768:Celsr1 UTSW 15 85,816,610 (GRCm39) missense probably benign
R7974:Celsr1 UTSW 15 85,915,231 (GRCm39) missense probably damaging 1.00
R7977:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R7987:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R8073:Celsr1 UTSW 15 85,823,356 (GRCm39) missense probably benign 0.00
R8099:Celsr1 UTSW 15 85,915,801 (GRCm39) missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85,787,090 (GRCm39) missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85,863,436 (GRCm39) missense probably benign 0.00
R8289:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8290:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8292:Celsr1 UTSW 15 85,791,819 (GRCm39) missense possibly damaging 0.90
R8328:Celsr1 UTSW 15 85,806,445 (GRCm39) missense probably benign 0.00
R8330:Celsr1 UTSW 15 85,816,501 (GRCm39) missense probably damaging 0.99
R8333:Celsr1 UTSW 15 85,915,615 (GRCm39) missense possibly damaging 0.65
R8352:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8452:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8463:Celsr1 UTSW 15 85,914,415 (GRCm39) missense probably damaging 1.00
R8479:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8480:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8493:Celsr1 UTSW 15 85,822,207 (GRCm39) missense possibly damaging 0.67
R8498:Celsr1 UTSW 15 85,823,306 (GRCm39) missense probably benign 0.01
R8506:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8771:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R8891:Celsr1 UTSW 15 85,822,194 (GRCm39) missense probably benign 0.01
R8905:Celsr1 UTSW 15 85,788,269 (GRCm39) intron probably benign
R8924:Celsr1 UTSW 15 85,916,671 (GRCm39) missense possibly damaging 0.94
R8979:Celsr1 UTSW 15 85,847,340 (GRCm39) missense probably damaging 0.96
R9069:Celsr1 UTSW 15 85,914,772 (GRCm39) missense possibly damaging 0.53
R9115:Celsr1 UTSW 15 85,803,217 (GRCm39) missense probably damaging 1.00
R9194:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9196:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9198:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9200:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9201:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9202:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9203:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9222:Celsr1 UTSW 15 85,815,471 (GRCm39) missense possibly damaging 0.68
R9236:Celsr1 UTSW 15 85,915,051 (GRCm39) missense probably damaging 1.00
R9384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9386:Celsr1 UTSW 15 85,863,231 (GRCm39) missense probably damaging 1.00
R9400:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9401:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9415:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9428:Celsr1 UTSW 15 85,815,549 (GRCm39) missense possibly damaging 0.64
R9435:Celsr1 UTSW 15 85,806,535 (GRCm39) splice site probably benign
R9493:Celsr1 UTSW 15 85,785,346 (GRCm39) missense probably damaging 0.98
R9495:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9499:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9607:Celsr1 UTSW 15 85,915,229 (GRCm39) missense
R9673:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
Z1176:Celsr1 UTSW 15 85,847,301 (GRCm39) missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85,863,052 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCTCCTCAACCATCCAGAG -3'
(R):5'- CACGTTATCATGGCAGAGTGAGTG -3'

Sequencing Primer
(F):5'- CGACATATTCCCAAGGGATGC -3'
(R):5'- TGGGGAAAGCAAACTAGGGC -3'
Posted On 2014-09-17