Mutagenetix > Incidental Mutation

Incidental Mutation 'R2131:Celsr1'

228127

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

crash, Crsh, Scy

MMRRC Submission

040134-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.671) question?

Stock #

R2131 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85898929-86033777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85963223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1438 (I1438F)

Ref Sequence

ENSEMBL: ENSMUSP00000016172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000016172
AA Change: I1438F

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: I1438F

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000226840
AA Change: I71F

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 123 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,210,149	C656S	probably benign	Het
4931408C20Rik	T	C	1: 26,685,854	R82G	probably benign	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
A2ml1	T	A	6: 128,576,260	N178I	probably damaging	Het
Acvr2b	A	G	9: 119,432,808	R437G	probably damaging	Het
Adamtsl3	C	A	7: 82,578,594	A1329E	probably damaging	Het
Adgrl2	T	C	3: 148,890,488	I71V	probably damaging	Het
Adra1a	A	T	14: 66,727,532	I324F	possibly damaging	Het
Akap13	G	T	7: 75,611,434	A1269S	probably benign	Het
Ampd1	G	T	3: 103,094,878		probably null	Het
Ankrd16	T	A	2: 11,783,695	D211E	probably damaging	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Apc	C	A	18: 34,312,045	Q665K	possibly damaging	Het
Arap2	T	C	5: 62,677,958	N747S	probably damaging	Het
Arsk	A	T	13: 76,091,812	C47*	probably null	Het
Atp8b5	T	A	4: 43,370,726	F1001I	probably benign	Het
Bap1	T	A	14: 31,258,331	Y645*	probably null	Het
Brca2	A	G	5: 150,557,129	Y2760C	probably damaging	Het
Cad	T	A	5: 31,058,072	F76I	probably damaging	Het
Capn9	G	A	8: 124,605,711	G430R	possibly damaging	Het
Ccdc27	TTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTC	4: 154,036,306		probably benign	Het
Cdkn2c	A	C	4: 109,665,063	N28K	probably null	Het
Cfhr2	T	G	1: 139,831,155	R52S	probably benign	Het
Cldn1	G	C	16: 26,371,550	A26G	probably damaging	Het
Col20a1	T	A	2: 180,992,573	F110L	probably damaging	Het
Creg2	T	C	1: 39,624,978	N204S	probably benign	Het
Cx3cl1	C	A	8: 94,779,573	Q69K	probably benign	Het
Cyfip2	T	C	11: 46,286,131	E74G	possibly damaging	Het
Cyp2g1	A	T	7: 26,820,710	I456F	probably damaging	Het
Dapk1	A	G	13: 60,729,531	E528G	possibly damaging	Het
Dapk1	T	A	13: 60,761,667	W1365R	possibly damaging	Het
Dbt	T	A	3: 116,539,124	D16E	probably damaging	Het
Depdc5	T	A	5: 32,990,781	L1469*	probably null	Het
Dnah3	T	A	7: 119,967,759	T2415S	possibly damaging	Het
Dnmbp	A	G	19: 43,854,311	L1210S	probably damaging	Het
Dpyd	T	C	3: 118,674,568	V77A	probably benign	Het
Eps15l1	A	T	8: 72,386,868	V260D	probably benign	Het
Eya1	A	G	1: 14,170,974	V573A	probably benign	Het
Fam171b	T	A	2: 83,879,858	S625T	probably damaging	Het
Fam186a	T	C	15: 99,933,676		probably benign	Het
Fam208a	A	G	14: 27,476,614	N1301S	possibly damaging	Het
Gabra4	G	T	5: 71,641,224	D137E	probably benign	Het
Gatsl2	G	A	5: 134,136,153	C187Y	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Gm43302	T	C	5: 105,274,744	D474G	probably damaging	Het
Golim4	A	T	3: 75,908,149	V116D	probably damaging	Het
Gpr19	T	C	6: 134,870,442	M1V	probably null	Het
Hnf4a	T	A	2: 163,547,418	N29K	probably benign	Het
Htt	A	G	5: 34,877,109	R1975G	possibly damaging	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Il4i1	G	A	7: 44,840,070	V420M	probably damaging	Het
Insrr	G	A	3: 87,810,572		probably null	Het
Ipo9	ATCCTCCTCCTCCTCCTC	ATCCTCCTCCTCCTCCTCCTC	1: 135,386,268		probably benign	Het
Ipo9	A	G	1: 135,402,250	V484A	probably benign	Het
Jmjd4	A	T	11: 59,454,955	H287L	probably damaging	Het
Kcnj13	A	G	1: 87,386,534	V322A	probably benign	Het
Kdm5d	T	C	Y: 941,483	L1228P	probably benign	Het
Klra3	A	G	6: 130,335,775	S9P	probably benign	Het
Ldhd	C	T	8: 111,628,537		probably null	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lmo7	A	T	14: 101,900,238	D670V	probably damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Lrp5	T	C	19: 3,622,708	T534A	possibly damaging	Het
Lrrc24	A	T	15: 76,715,581	F453I	possibly damaging	Het
Magel2	A	T	7: 62,377,738	H130L	unknown	Het
Mcpt8	T	C	14: 56,082,283	I237V	probably damaging	Het
Med4	A	G	14: 73,517,996	N248S	possibly damaging	Het
Mest	C	T	6: 30,745,885	L269F	probably damaging	Het
Mib2	C	T	4: 155,655,238		probably null	Het
Mki67	T	A	7: 135,704,241		probably null	Het
Mnx1	T	A	5: 29,474,189	S299C	unknown	Het
Nbr1	T	A	11: 101,566,191		probably null	Het
Ncapd3	T	G	9: 27,083,346	V1174G	probably damaging	Het
Nyap1	A	C	5: 137,733,681		probably null	Het
Olfml3	T	A	3: 103,735,869	M399L	probably benign	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr775	T	C	10: 129,251,074	F180S	probably benign	Het
Oosp1	T	C	19: 11,690,950	D23G	probably damaging	Het
Optc	A	T	1: 133,903,796		probably null	Het
Osbpl6	T	A	2: 76,586,214	I546K	probably damaging	Het
Otog	A	T	7: 46,250,100	N275I	probably damaging	Het
Pcdhb14	C	A	18: 37,447,870	Q10K	probably benign	Het
Pcx	T	C	19: 4,602,551	F189L	probably benign	Het
Pde6b	A	G	5: 108,428,203	D718G	probably damaging	Het
Pklr	C	A	3: 89,142,660	P314Q	probably damaging	Het
Plcb1	T	A	2: 135,325,667	Y460*	probably null	Het
Plekha6	C	A	1: 133,279,365		probably null	Het
Plekho1	A	G	3: 95,989,117	S347P	probably damaging	Het
Plxna2	G	A	1: 194,644,750	D331N	probably benign	Het
Prelp	C	T	1: 133,915,131	R92K	probably benign	Het
Prkra	A	T	2: 76,647,136	I75K	probably damaging	Het
Ptpn11	G	A	5: 121,172,026	A31V	probably damaging	Het
Pzp	T	C	6: 128,491,161		probably null	Het
Rbm12	A	T	2: 156,095,510	C947*	probably null	Het
Ren1	C	G	1: 133,350,778		probably null	Het
Sarm1	A	T	11: 78,475,307	C649S	probably benign	Het
Sept12	T	A	16: 4,991,779	Q223L	probably damaging	Het
Sept4	A	T	11: 87,583,436	Q60L	probably benign	Het
Slc22a21	A	T	11: 53,979,733	L42Q	probably damaging	Het
Slc44a1	GCCC	GCCCCCCC	4: 53,563,246		probably null	Het
Slc9a4	T	G	1: 40,607,741		probably null	Het
Sort1	T	A	3: 108,351,686	F678Y	probably benign	Het
Spag6	T	A	2: 18,733,097	C259*	probably null	Het
Stard13	T	C	5: 151,045,168	Y879C	probably damaging	Het
Stk24	A	T	14: 121,302,211	I191N	probably damaging	Het
Tacc1	A	T	8: 25,164,493	N271K	probably damaging	Het
Tacc2	T	A	7: 130,621,857	S91T	possibly damaging	Het
Tacr3	T	C	3: 134,932,180	V366A	probably benign	Het
Tbccd1	A	G	16: 22,841,989	S26P	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tor1aip2	A	G	1: 156,065,349	Y467C	probably damaging	Het
Trove2	T	C	1: 143,760,034	D458G	probably benign	Het
Ttc9b	T	A	7: 27,654,349		probably null	Het
Tti1	T	C	2: 158,000,743	R789G	probably benign	Het
Ttn	A	T	2: 76,832,217		probably null	Het
Txk	T	A	5: 72,696,579	T472S	probably damaging	Het
Ube2cbp	A	T	9: 86,372,487		probably null	Het
Vav2	C	A	2: 27,299,396	R176L	possibly damaging	Het
Wdr27	T	A	17: 14,928,332	D133V	probably damaging	Het
Zc3h7a	A	T	16: 11,150,605	Y503*	probably null	Het
Zdhhc13	T	A	7: 48,824,644	L548Q	possibly damaging	Het
Zfp467	A	C	6: 48,442,661	S38A	probably damaging	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85931345	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	86030836	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85922235	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	86030491	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85926190	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85929895	missense	probably benign
IGL01931:Celsr1	APN	15	85907660	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85963223	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85907721	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85979004	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85929907	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	86031226	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85941136	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85900688	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	86030617	nonsense	probably null
IGL02899:Celsr1	APN	15	86031726	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85901472	missense	probably benign
IGL03212:Celsr1	APN	15	85930677	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85922235	missense	probably damaging	1.00
PIT4305001:Celsr1	UTSW	15	85900937	missense	possibly damaging	0.87
PIT4480001:Celsr1	UTSW	15	86032414	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0038:Celsr1	UTSW	15	85929419	missense	possibly damaging	0.65
R0057:Celsr1	UTSW	15	86030762	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85902864	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85903365	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85932323	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85901597	missense	probably benign
R0792:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85903288	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	86031279	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	86032047	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85979146	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1522:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	86031062	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85932457	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	86030323	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	86032685	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	86032759	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	86032887	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	86030547	missense	probably benign	0.02
R2132:Celsr1	UTSW	15	86031967	missense	possibly damaging	0.91
R2189:Celsr1	UTSW	15	85979230	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85916723	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	86031807	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85978827	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85963133	missense	probably benign	0.00
R4414:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4416:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85916756	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	86030494	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85932460	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85906029	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85937953	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85937911	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85939134	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85932384	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85930546	missense	probably benign
R5310:Celsr1	UTSW	15	85926222	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R5484:Celsr1	UTSW	15	85931282	missense	probably benign	0.00
R5639:Celsr1	UTSW	15	86030767	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85941264	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	86032955	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85904014	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	85937975	missense	probably benign
R5915:Celsr1	UTSW	15	86030349	missense	probably damaging	0.96
R5932:Celsr1	UTSW	15	86032704	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	86032500	missense	probably damaging	1.00
R5975:Celsr1	UTSW	15	85919038	splice site	probably null
R6050:Celsr1	UTSW	15	85930611	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85932411	missense	probably benign	0.04
R6178:Celsr1	UTSW	15	85901021	missense	probably benign	0.08
R6186:Celsr1	UTSW	15	85921193	missense	possibly damaging	0.84
R6212:Celsr1	UTSW	15	85916687	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85928330	missense	probably benign
R6320:Celsr1	UTSW	15	85900959	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	86031684	missense	probably damaging	1.00
R6478:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R6504:Celsr1	UTSW	15	85978920	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85963285	missense	probably benign
R6615:Celsr1	UTSW	15	85902114	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85918934	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85905914	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85907598	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	86031495	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	86030782	missense	probably benign
R6838:Celsr1	UTSW	15	85939194	missense	probably benign
R6886:Celsr1	UTSW	15	86031654	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85905478	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	86032655	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85932451	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	86033008	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	86030514	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	86030674	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85907673	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	86033392	missense	probably benign
R7491:Celsr1	UTSW	15	86032518	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85929872	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85978732	nonsense	probably null
R7741:Celsr1	UTSW	15	85979102	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85932409	missense	probably benign
R7974:Celsr1	UTSW	15	86031030	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85939155	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	86031600	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85902889	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85979235	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	86033085	nonsense	probably null
R8290:Celsr1	UTSW	15	86033085	nonsense	probably null
R8292:Celsr1	UTSW	15	85907618	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85922244	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85932300	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	86031414	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	86033085	nonsense	probably null
R8384:Celsr1	UTSW	15	86033085	nonsense	probably null
R8452:Celsr1	UTSW	15	86033085	nonsense	probably null
R8463:Celsr1	UTSW	15	86030214	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	86033085	nonsense	probably null
R8480:Celsr1	UTSW	15	86033085	nonsense	probably null
R8493:Celsr1	UTSW	15	85938006	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85939105	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	86033085	nonsense	probably null
R8771:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R8891:Celsr1	UTSW	15	85937993	missense	probably benign	0.01
R8905:Celsr1	UTSW	15	85904068	intron	probably benign
R8924:Celsr1	UTSW	15	86032470	missense	possibly damaging	0.94
R8979:Celsr1	UTSW	15	85963139	missense	probably damaging	0.96
R9069:Celsr1	UTSW	15	86030571	missense	possibly damaging	0.53
R9115:Celsr1	UTSW	15	85919016	missense	probably damaging	1.00
R9194:Celsr1	UTSW	15	86033085	nonsense	probably null
R9196:Celsr1	UTSW	15	86033085	nonsense	probably null
R9198:Celsr1	UTSW	15	86033085	nonsense	probably null
R9200:Celsr1	UTSW	15	86033085	nonsense	probably null
R9201:Celsr1	UTSW	15	86033085	nonsense	probably null
R9202:Celsr1	UTSW	15	86033085	nonsense	probably null
R9203:Celsr1	UTSW	15	86033085	nonsense	probably null
R9222:Celsr1	UTSW	15	85931270	missense	possibly damaging	0.68
R9236:Celsr1	UTSW	15	86030850	missense	probably damaging	1.00
R9384:Celsr1	UTSW	15	86033085	nonsense	probably null
R9386:Celsr1	UTSW	15	85979030	missense	probably damaging	1.00
R9400:Celsr1	UTSW	15	86033085	nonsense	probably null
R9401:Celsr1	UTSW	15	86033085	nonsense	probably null
R9415:Celsr1	UTSW	15	86033085	nonsense	probably null
R9428:Celsr1	UTSW	15	85931348	missense	possibly damaging	0.64
R9435:Celsr1	UTSW	15	85922334	splice site	probably benign
R9493:Celsr1	UTSW	15	85901145	missense	probably damaging	0.98
R9495:Celsr1	UTSW	15	86033085	nonsense	probably null
R9499:Celsr1	UTSW	15	86033085	nonsense	probably null
R9607:Celsr1	UTSW	15	86031028	missense
R9673:Celsr1	UTSW	15	86033085	nonsense	probably null
Z1176:Celsr1	UTSW	15	85963100	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85978851	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCTCCTCAACCATCCAGAG -3'
(R):5'- CACGTTATCATGGCAGAGTGAGTG -3'

Sequencing Primer
(F):5'- CGACATATTCCCAAGGGATGC -3'
(R):5'- TGGGGAAAGCAAACTAGGGC -3'

Posted On

2014-09-17