Incidental Mutation 'R2131:Apc'
ID 228135
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Name APC, WNT signaling pathway regulator
Synonyms Min, adenomatosis polyposis coli, CC1
MMRRC Submission 040134-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R2131 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 34353977-34455605 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34445098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 665 (Q665K)
Ref Sequence ENSEMBL: ENSMUSP00000078337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000079362
AA Change: Q665K

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: Q665K

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115781
AA Change: Q631K

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: Q631K

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165590
SMART Domains Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:3AU3|A 2 33 2e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167136
Predicted Effect probably benign
Transcript: ENSMUST00000171187
AA Change: Q647K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871
AA Change: Q647K

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Acvr2b A G 9: 119,261,874 (GRCm39) R437G probably damaging Het
Adamtsl3 C A 7: 82,227,802 (GRCm39) A1329E probably damaging Het
Adgrl2 T C 3: 148,596,124 (GRCm39) I71V probably damaging Het
Adra1a A T 14: 66,964,981 (GRCm39) I324F possibly damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Ampd1 G T 3: 103,002,194 (GRCm39) probably null Het
Ankrd16 T A 2: 11,788,506 (GRCm39) D211E probably damaging Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Arap2 T C 5: 62,835,301 (GRCm39) N747S probably damaging Het
Arsk A T 13: 76,239,931 (GRCm39) C47* probably null Het
Atp8b5 T A 4: 43,370,726 (GRCm39) F1001I probably benign Het
Bap1 T A 14: 30,980,288 (GRCm39) Y645* probably null Het
Brca2 A G 5: 150,480,594 (GRCm39) Y2760C probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Castor2 G A 5: 134,164,992 (GRCm39) C187Y probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,120,763 (GRCm39) probably benign Het
Cdkn2c A C 4: 109,522,260 (GRCm39) N28K probably null Het
Celsr1 T A 15: 85,847,424 (GRCm39) I1438F probably benign Het
Cfhr2 T G 1: 139,758,893 (GRCm39) R52S probably benign Het
Cldn1 G C 16: 26,190,300 (GRCm39) A26G probably damaging Het
Col20a1 T A 2: 180,634,366 (GRCm39) F110L probably damaging Het
Creg2 T C 1: 39,664,146 (GRCm39) N204S probably benign Het
Cx3cl1 C A 8: 95,506,201 (GRCm39) Q69K probably benign Het
Cyfip2 T C 11: 46,176,958 (GRCm39) E74G possibly damaging Het
Cyp2g1 A T 7: 26,520,135 (GRCm39) I456F probably damaging Het
Dapk1 T A 13: 60,909,481 (GRCm39) W1365R possibly damaging Het
Dapk1 A G 13: 60,877,345 (GRCm39) E528G possibly damaging Het
Dbt T A 3: 116,332,773 (GRCm39) D16E probably damaging Het
Depdc5 T A 5: 33,148,125 (GRCm39) L1469* probably null Het
Dnah3 T A 7: 119,566,982 (GRCm39) T2415S possibly damaging Het
Dnmbp A G 19: 43,842,750 (GRCm39) L1210S probably damaging Het
Dpyd T C 3: 118,468,217 (GRCm39) V77A probably benign Het
Eps15l1 A T 8: 73,140,712 (GRCm39) V260D probably benign Het
Eya1 A G 1: 14,241,198 (GRCm39) V573A probably benign Het
Fam171b T A 2: 83,710,202 (GRCm39) S625T probably damaging Het
Fam186a T C 15: 99,831,557 (GRCm39) probably benign Het
Gabra4 G T 5: 71,798,567 (GRCm39) D137E probably benign Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm43302 T C 5: 105,422,610 (GRCm39) D474G probably damaging Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gpr19 T C 6: 134,847,405 (GRCm39) M1V probably null Het
Hnf4a T A 2: 163,389,338 (GRCm39) N29K probably benign Het
Htt A G 5: 35,034,453 (GRCm39) R1975G possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Il4i1 G A 7: 44,489,494 (GRCm39) V420M probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Jmjd4 A T 11: 59,345,781 (GRCm39) H287L probably damaging Het
Kcnj13 A G 1: 87,314,256 (GRCm39) V322A probably benign Het
Kdm5d T C Y: 941,483 (GRCm39) L1228P probably benign Het
Klra3 A G 6: 130,312,738 (GRCm39) S9P probably benign Het
Ldhd C T 8: 112,355,169 (GRCm39) probably null Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lmo7 A T 14: 102,137,674 (GRCm39) D670V probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lrp5 T C 19: 3,672,708 (GRCm39) T534A possibly damaging Het
Lrrc24 A T 15: 76,599,781 (GRCm39) F453I possibly damaging Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mcpt8 T C 14: 56,319,740 (GRCm39) I237V probably damaging Het
Med4 A G 14: 73,755,436 (GRCm39) N248S possibly damaging Het
Mest C T 6: 30,745,884 (GRCm39) L269F probably damaging Het
Mib2 C T 4: 155,739,695 (GRCm39) probably null Het
Mki67 T A 7: 135,305,970 (GRCm39) probably null Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Nbr1 T A 11: 101,457,017 (GRCm39) probably null Het
Ncapd3 T G 9: 26,994,642 (GRCm39) V1174G probably damaging Het
Nyap1 A C 5: 137,731,943 (GRCm39) probably null Het
Olfml3 T A 3: 103,643,185 (GRCm39) M399L probably benign Het
Oosp1 T C 19: 11,668,314 (GRCm39) D23G probably damaging Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or6c205 T C 10: 129,086,943 (GRCm39) F180S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Otog A T 7: 45,899,524 (GRCm39) N275I probably damaging Het
Pcdhb14 C A 18: 37,580,923 (GRCm39) Q10K probably benign Het
Pcx T C 19: 4,652,579 (GRCm39) F189L probably benign Het
Pde6b A G 5: 108,576,069 (GRCm39) D718G probably damaging Het
Pklr C A 3: 89,049,967 (GRCm39) P314Q probably damaging Het
Plcb1 T A 2: 135,167,587 (GRCm39) Y460* probably null Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Plekho1 A G 3: 95,896,429 (GRCm39) S347P probably damaging Het
Plxna2 G A 1: 194,327,058 (GRCm39) D331N probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Prkra A T 2: 76,477,480 (GRCm39) I75K probably damaging Het
Ptpn11 G A 5: 121,310,089 (GRCm39) A31V probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Rbm12 A T 2: 155,937,430 (GRCm39) C947* probably null Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Sarm1 A T 11: 78,366,133 (GRCm39) C649S probably benign Het
Septin12 T A 16: 4,809,643 (GRCm39) Q223L probably damaging Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Slc22a21 A T 11: 53,870,559 (GRCm39) L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 (GRCm39) probably null Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Sort1 T A 3: 108,259,002 (GRCm39) F678Y probably benign Het
Spag6 T A 2: 18,737,908 (GRCm39) C259* probably null Het
Spata31e2 T C 1: 26,724,935 (GRCm39) R82G probably benign Het
Stard13 T C 5: 150,968,633 (GRCm39) Y879C probably damaging Het
Stk24 A T 14: 121,539,623 (GRCm39) I191N probably damaging Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tacc2 T A 7: 130,223,587 (GRCm39) S91T possibly damaging Het
Tacr3 T C 3: 134,637,941 (GRCm39) V366A probably benign Het
Tasor A G 14: 27,198,571 (GRCm39) N1301S possibly damaging Het
Tbccd1 A G 16: 22,660,739 (GRCm39) S26P probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tor1aip2 A G 1: 155,941,095 (GRCm39) Y467C probably damaging Het
Ttc9b T A 7: 27,353,774 (GRCm39) probably null Het
Tti1 T C 2: 157,842,663 (GRCm39) R789G probably benign Het
Ttn A T 2: 76,662,561 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ube3d A T 9: 86,254,540 (GRCm39) probably null Het
Vav2 C A 2: 27,189,408 (GRCm39) R176L possibly damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Wdr27 T A 17: 15,148,594 (GRCm39) D133V probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp467 A C 6: 48,419,595 (GRCm39) S38A probably damaging Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34,449,979 (GRCm39) missense probably benign 0.01
IGL00898:Apc APN 18 34,450,147 (GRCm39) missense probably damaging 1.00
IGL01111:Apc APN 18 34,448,189 (GRCm39) missense possibly damaging 0.95
IGL01347:Apc APN 18 34,450,723 (GRCm39) missense probably damaging 1.00
IGL01375:Apc APN 18 34,446,707 (GRCm39) missense probably damaging 1.00
IGL01805:Apc APN 18 34,451,271 (GRCm39) missense probably benign 0.02
IGL01997:Apc APN 18 34,448,476 (GRCm39) missense probably benign 0.00
IGL02033:Apc APN 18 34,443,772 (GRCm39) missense probably damaging 1.00
IGL02323:Apc APN 18 34,448,863 (GRCm39) nonsense probably null
IGL02373:Apc APN 18 34,449,212 (GRCm39) missense probably damaging 1.00
IGL02379:Apc APN 18 34,431,798 (GRCm39) missense probably benign 0.45
IGL02456:Apc APN 18 34,446,935 (GRCm39) nonsense probably null
IGL02552:Apc APN 18 34,446,035 (GRCm39) missense possibly damaging 0.90
IGL02676:Apc APN 18 34,448,687 (GRCm39) missense probably damaging 1.00
IGL02756:Apc APN 18 34,447,588 (GRCm39) missense probably damaging 1.00
IGL02938:Apc APN 18 34,448,281 (GRCm39) missense probably damaging 0.98
IGL02974:Apc APN 18 34,401,436 (GRCm39) splice site probably benign
IGL03124:Apc APN 18 34,433,038 (GRCm39) missense probably damaging 0.98
IGL03201:Apc APN 18 34,445,429 (GRCm39) missense probably damaging 1.00
IGL03339:Apc APN 18 34,431,527 (GRCm39) missense probably damaging 1.00
FR4304:Apc UTSW 18 34,415,050 (GRCm39) intron probably benign
FR4342:Apc UTSW 18 34,415,052 (GRCm39) intron probably benign
FR4449:Apc UTSW 18 34,415,058 (GRCm39) intron probably benign
FR4449:Apc UTSW 18 34,415,053 (GRCm39) intron probably benign
FR4548:Apc UTSW 18 34,415,051 (GRCm39) intron probably benign
FR4737:Apc UTSW 18 34,415,052 (GRCm39) intron probably benign
FR4976:Apc UTSW 18 34,415,057 (GRCm39) nonsense probably null
FR4976:Apc UTSW 18 34,415,053 (GRCm39) intron probably benign
FR4976:Apc UTSW 18 34,415,051 (GRCm39) intron probably benign
R0385:Apc UTSW 18 34,448,997 (GRCm39) missense probably damaging 1.00
R0535:Apc UTSW 18 34,394,125 (GRCm39) missense probably damaging 1.00
R0561:Apc UTSW 18 34,446,356 (GRCm39) missense possibly damaging 0.94
R0590:Apc UTSW 18 34,449,283 (GRCm39) nonsense probably null
R0626:Apc UTSW 18 34,451,507 (GRCm39) missense probably damaging 1.00
R0991:Apc UTSW 18 34,449,160 (GRCm39) missense probably damaging 1.00
R1564:Apc UTSW 18 34,448,202 (GRCm39) missense probably benign 0.00
R1663:Apc UTSW 18 34,401,378 (GRCm39) missense probably damaging 0.98
R1737:Apc UTSW 18 34,450,075 (GRCm39) missense probably damaging 1.00
R1739:Apc UTSW 18 34,445,371 (GRCm39) missense probably damaging 1.00
R1835:Apc UTSW 18 34,450,130 (GRCm39) missense probably damaging 1.00
R1887:Apc UTSW 18 34,405,521 (GRCm39) missense probably damaging 1.00
R1957:Apc UTSW 18 34,450,388 (GRCm39) missense probably damaging 1.00
R1974:Apc UTSW 18 34,433,057 (GRCm39) missense possibly damaging 0.62
R2005:Apc UTSW 18 34,443,962 (GRCm39) critical splice donor site probably null
R2013:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2014:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2015:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2017:Apc UTSW 18 34,446,655 (GRCm39) missense probably benign 0.00
R2056:Apc UTSW 18 34,449,481 (GRCm39) missense probably damaging 1.00
R2108:Apc UTSW 18 34,402,282 (GRCm39) missense probably damaging 1.00
R2120:Apc UTSW 18 34,409,654 (GRCm39) missense probably damaging 1.00
R2133:Apc UTSW 18 34,445,098 (GRCm39) missense possibly damaging 0.51
R2291:Apc UTSW 18 34,445,544 (GRCm39) missense probably benign 0.45
R2332:Apc UTSW 18 34,450,112 (GRCm39) missense possibly damaging 0.50
R2360:Apc UTSW 18 34,394,179 (GRCm39) missense probably damaging 1.00
R2407:Apc UTSW 18 34,447,315 (GRCm39) missense possibly damaging 0.77
R2507:Apc UTSW 18 34,449,590 (GRCm39) missense possibly damaging 0.77
R2940:Apc UTSW 18 34,409,723 (GRCm39) missense probably damaging 1.00
R3404:Apc UTSW 18 34,446,655 (GRCm39) missense probably benign 0.00
R3411:Apc UTSW 18 34,402,312 (GRCm39) splice site probably benign
R3778:Apc UTSW 18 34,446,134 (GRCm39) missense probably damaging 1.00
R3826:Apc UTSW 18 34,412,388 (GRCm39) missense possibly damaging 0.93
R4599:Apc UTSW 18 34,451,040 (GRCm39) nonsense probably null
R4611:Apc UTSW 18 34,451,618 (GRCm39) missense probably damaging 1.00
R4664:Apc UTSW 18 34,431,647 (GRCm39) missense probably damaging 0.98
R4969:Apc UTSW 18 34,445,971 (GRCm39) nonsense probably null
R5007:Apc UTSW 18 34,446,016 (GRCm39) missense probably damaging 1.00
R5066:Apc UTSW 18 34,449,158 (GRCm39) missense probably damaging 1.00
R5112:Apc UTSW 18 34,449,162 (GRCm39) nonsense probably null
R5259:Apc UTSW 18 34,447,343 (GRCm39) missense probably benign 0.29
R5440:Apc UTSW 18 34,354,213 (GRCm39) unclassified probably benign
R5508:Apc UTSW 18 34,431,633 (GRCm39) missense probably damaging 0.97
R5512:Apc UTSW 18 34,443,962 (GRCm39) critical splice donor site probably benign
R5850:Apc UTSW 18 34,451,116 (GRCm39) missense possibly damaging 0.94
R5951:Apc UTSW 18 34,450,199 (GRCm39) missense possibly damaging 0.89
R5966:Apc UTSW 18 34,354,140 (GRCm39) utr 5 prime probably benign
R6081:Apc UTSW 18 34,423,164 (GRCm39) missense possibly damaging 0.93
R6116:Apc UTSW 18 34,449,508 (GRCm39) missense probably damaging 1.00
R6351:Apc UTSW 18 34,445,265 (GRCm39) missense probably damaging 1.00
R6354:Apc UTSW 18 34,445,581 (GRCm39) missense probably benign 0.02
R6467:Apc UTSW 18 34,402,252 (GRCm39) missense probably benign 0.22
R6974:Apc UTSW 18 34,431,480 (GRCm39) missense possibly damaging 0.65
R7027:Apc UTSW 18 34,445,129 (GRCm39) missense probably damaging 1.00
R7096:Apc UTSW 18 34,449,010 (GRCm39) missense probably damaging 1.00
R7289:Apc UTSW 18 34,448,324 (GRCm39) missense probably damaging 1.00
R7439:Apc UTSW 18 34,445,126 (GRCm39) missense probably damaging 1.00
R7441:Apc UTSW 18 34,445,126 (GRCm39) missense probably damaging 1.00
R7534:Apc UTSW 18 34,450,015 (GRCm39) missense probably damaging 1.00
R7685:Apc UTSW 18 34,447,261 (GRCm39) missense probably damaging 1.00
R7814:Apc UTSW 18 34,405,592 (GRCm39) missense probably damaging 0.98
R7954:Apc UTSW 18 34,447,321 (GRCm39) missense probably damaging 0.99
R8352:Apc UTSW 18 34,445,804 (GRCm39) missense possibly damaging 0.54
R8452:Apc UTSW 18 34,445,804 (GRCm39) missense possibly damaging 0.54
R8497:Apc UTSW 18 34,446,083 (GRCm39) missense possibly damaging 0.81
R8545:Apc UTSW 18 34,450,084 (GRCm39) missense possibly damaging 0.94
R8554:Apc UTSW 18 34,445,999 (GRCm39) missense probably damaging 1.00
R8955:Apc UTSW 18 34,401,370 (GRCm39) missense probably damaging 1.00
R9014:Apc UTSW 18 34,354,074 (GRCm39) start gained probably benign
R9061:Apc UTSW 18 34,446,251 (GRCm39) missense probably damaging 1.00
R9147:Apc UTSW 18 34,450,710 (GRCm39) missense probably damaging 1.00
R9318:Apc UTSW 18 34,447,040 (GRCm39) missense possibly damaging 0.69
R9521:Apc UTSW 18 34,445,738 (GRCm39) missense probably benign 0.24
R9546:Apc UTSW 18 34,445,311 (GRCm39) missense possibly damaging 0.86
R9547:Apc UTSW 18 34,445,311 (GRCm39) missense possibly damaging 0.86
R9557:Apc UTSW 18 34,451,412 (GRCm39) missense probably damaging 1.00
R9592:Apc UTSW 18 34,443,823 (GRCm39) nonsense probably null
R9675:Apc UTSW 18 34,449,247 (GRCm39) missense probably damaging 1.00
R9736:Apc UTSW 18 34,450,823 (GRCm39) missense probably damaging 1.00
R9792:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
R9793:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
R9795:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
RF046:Apc UTSW 18 34,415,062 (GRCm39) critical splice donor site probably benign
RF063:Apc UTSW 18 34,415,062 (GRCm39) critical splice donor site probably benign
X0021:Apc UTSW 18 34,445,161 (GRCm39) missense probably damaging 1.00
X0025:Apc UTSW 18 34,445,429 (GRCm39) missense probably damaging 1.00
Z1088:Apc UTSW 18 34,446,220 (GRCm39) nonsense probably null
Z1177:Apc UTSW 18 34,447,516 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CATTGACTGGACCAAGAGAGC -3'
(R):5'- GGTCTGTTTGCCATGAGATTCC -3'

Sequencing Primer
(F):5'- CTGGACCAAGAGAGCAGGAAG -3'
(R):5'- GCCATGAGATTCCTTAAAGCTGCTG -3'
Posted On 2014-09-17