Incidental Mutation 'R2056:Slc27a4'
ID228156
Institutional Source Beutler Lab
Gene Symbol Slc27a4
Ensembl Gene ENSMUSG00000059316
Gene Namesolute carrier family 27 (fatty acid transporter), member 4
SynonymsFATP4, fatty acid transport protein 4
MMRRC Submission 040061-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2056 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29802634-29817522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29810941 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 320 (W320R)
Ref Sequence ENSEMBL: ENSMUSP00000078971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080065]
Predicted Effect probably damaging
Transcript: ENSMUST00000080065
AA Change: W320R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078971
Gene: ENSMUSG00000059316
AA Change: W320R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:AMP-binding 80 512 1.2e-72 PFAM
Pfam:AMP-binding_C 520 595 2.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136444
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutant mice are not viable. While mice of one mutant line die during early development, mice of other mutant lines die at birth exhibiting abnormal skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,573,745 R575G possibly damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adh1 A G 3: 138,286,915 D264G probably damaging Het
Ahnak2 T A 12: 112,785,006 D407V probably benign Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ankmy1 T C 1: 92,881,831 I662V possibly damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apc A G 18: 34,316,428 R2092G probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Brap G A 5: 121,663,466 G95S probably damaging Het
Cbfa2t2 G A 2: 154,535,157 A587T probably damaging Het
Ccdc180 A G 4: 45,932,477 I1308V probably benign Het
Ccser1 T A 6: 61,422,952 probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Cntln G A 4: 85,049,674 R710K probably benign Het
Csn1s1 A T 5: 87,671,528 T15S possibly damaging Het
Cul9 T C 17: 46,543,372 T135A probably benign Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dhx38 G T 8: 109,562,720 probably benign Het
Dis3 A T 14: 99,098,815 I85N possibly damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dscaml1 A G 9: 45,750,132 D1776G probably damaging Het
Erbin A G 13: 103,830,316 S1209P probably benign Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Fbxo45 G T 16: 32,238,528 Q183K possibly damaging Het
Frmd4b C T 6: 97,412,487 probably null Het
Fzd7 A G 1: 59,484,202 S415G probably benign Het
Gpd2 T A 2: 57,339,013 probably null Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gstcd T C 3: 133,082,053 I295V probably benign Het
Gucy1a1 A G 3: 82,109,285 L132P possibly damaging Het
Il12b A C 11: 44,407,900 T61P probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Itih3 A C 14: 30,909,524 probably null Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Kif11 A G 19: 37,402,212 N408D probably benign Het
Kng2 TATGACCATGACCATGACCATGACCATGACCATGACCAT TATGACCATGACCATGACCATGACCATGACCAT 16: 22,987,953 probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Krt9 G T 11: 100,191,495 N201K probably damaging Het
Lmbr1 G A 5: 29,233,094 P304L probably benign Het
Lrrfip1 A G 1: 91,115,817 N648S probably benign Het
Mab21l3 C A 3: 101,815,153 V386L possibly damaging Het
Mamdc4 T C 2: 25,564,168 Q1149R probably benign Het
Mast1 A G 8: 84,920,366 F677L possibly damaging Het
Mcoln3 A G 3: 146,128,224 D173G probably benign Het
Mmrn1 C T 6: 60,944,805 T82I probably benign Het
Muc5ac A G 7: 141,792,035 T203A probably benign Het
Myo9b T C 8: 71,359,690 I2035T possibly damaging Het
Ndst3 T C 3: 123,671,885 N146S probably damaging Het
Neu4 A G 1: 94,022,450 T21A possibly damaging Het
Nos1ap G A 1: 170,327,646 L267F probably damaging Het
Olfr1208 A G 2: 88,896,761 F279L probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr399 A T 11: 74,053,993 Y255* probably null Het
Phc1 T C 6: 122,333,340 N136S probably damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Psd2 A G 18: 36,006,691 D596G possibly damaging Het
Psmc3 T C 2: 91,058,088 F315L probably benign Het
Rerg G A 6: 137,057,880 T42I probably benign Het
Rif1 T A 2: 52,093,576 M577K probably damaging Het
Sap30 T C 8: 57,487,248 probably null Het
Scn2b T C 9: 45,125,517 Y108H probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb2 T C 1: 107,523,813 V232A probably damaging Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Soga1 C T 2: 157,022,827 G1154S probably benign Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thbs4 T A 13: 92,790,879 D34V probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem56 T G 3: 121,207,421 I188L probably benign Het
Tmod2 T C 9: 75,577,242 E248G probably benign Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ttn T C 2: 76,785,538 D8360G possibly damaging Het
Unc80 A G 1: 66,640,552 E2094G possibly damaging Het
Vmn2r18 A T 5: 151,584,695 D321E probably damaging Het
Other mutations in Slc27a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc27a4 APN 2 29804302 missense probably benign 0.03
IGL01982:Slc27a4 APN 2 29812615 missense probably damaging 1.00
IGL02160:Slc27a4 APN 2 29805962 missense probably benign 0.04
IGL02290:Slc27a4 APN 2 29815729 missense probably damaging 1.00
IGL02382:Slc27a4 APN 2 29809843 missense probably damaging 1.00
IGL02738:Slc27a4 APN 2 29811226 missense probably benign 0.15
R0470:Slc27a4 UTSW 2 29804185 missense probably benign 0.10
R0688:Slc27a4 UTSW 2 29812615 missense probably damaging 1.00
R0847:Slc27a4 UTSW 2 29811249 missense probably benign 0.20
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1584:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1793:Slc27a4 UTSW 2 29805721 missense probably benign 0.00
R1804:Slc27a4 UTSW 2 29811267 missense probably benign 0.01
R4901:Slc27a4 UTSW 2 29812636 missense probably damaging 1.00
R5601:Slc27a4 UTSW 2 29805660 missense probably benign 0.30
R5663:Slc27a4 UTSW 2 29812370 missense probably damaging 1.00
R5934:Slc27a4 UTSW 2 29811660 missense probably damaging 0.96
R6196:Slc27a4 UTSW 2 29805750 missense probably benign 0.00
R6643:Slc27a4 UTSW 2 29812848 missense probably benign 0.01
R7033:Slc27a4 UTSW 2 29804271 missense possibly damaging 0.94
R7176:Slc27a4 UTSW 2 29811226 missense probably benign 0.15
R7179:Slc27a4 UTSW 2 29815652 nonsense probably null
R7192:Slc27a4 UTSW 2 29805929 missense probably damaging 1.00
R7301:Slc27a4 UTSW 2 29812932 missense probably null 0.99
R7500:Slc27a4 UTSW 2 29812705 missense probably damaging 0.99
R7810:Slc27a4 UTSW 2 29805710 missense probably benign 0.25
R8042:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGAGGTGTGGCCAGTTAGC -3'
(R):5'- TCCCTCTCATCCGAGCAATG -3'

Sequencing Primer
(F):5'- GCTAGCCTGGACTATTTGAGACC -3'
(R):5'- CAGTGTATGGGTGGCAA -3'
Posted On2014-09-17