Incidental Mutation 'R2056:Gpd2'
ID228158
Institutional Source Beutler Lab
Gene Symbol Gpd2
Ensembl Gene ENSMUSG00000026827
Gene Nameglycerol phosphate dehydrogenase 2, mitochondrial
SynonymsGdm1
MMRRC Submission 040061-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R2056 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location57237635-57370719 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 57339013 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000028167] [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000112618] [ENSMUST00000112618] [ENSMUST00000169687] [ENSMUST00000169687] [ENSMUST00000169687]
Predicted Effect probably null
Transcript: ENSMUST00000028167
SMART Domains Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000028167
SMART Domains Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000028167
SMART Domains Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112618
SMART Domains Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 143 4.6e-7 PFAM
Pfam:DAO 71 441 2.9e-50 PFAM
Pfam:DAO_C 462 588 2.1e-42 PFAM
EFh 645 673 1.38e1 SMART
EFh 681 709 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112618
SMART Domains Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 143 4.6e-7 PFAM
Pfam:DAO 71 441 2.9e-50 PFAM
Pfam:DAO_C 462 588 2.1e-42 PFAM
EFh 645 673 1.38e1 SMART
EFh 681 709 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112618
SMART Domains Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 143 4.6e-7 PFAM
Pfam:DAO 71 441 2.9e-50 PFAM
Pfam:DAO_C 462 588 2.1e-42 PFAM
EFh 645 673 1.38e1 SMART
EFh 681 709 1.27e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141536
Predicted Effect probably null
Transcript: ENSMUST00000169687
SMART Domains Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169687
SMART Domains Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169687
SMART Domains Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,573,745 R575G possibly damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adh1 A G 3: 138,286,915 D264G probably damaging Het
Ahnak2 T A 12: 112,785,006 D407V probably benign Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ankmy1 T C 1: 92,881,831 I662V possibly damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apc A G 18: 34,316,428 R2092G probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Brap G A 5: 121,663,466 G95S probably damaging Het
Cbfa2t2 G A 2: 154,535,157 A587T probably damaging Het
Ccdc180 A G 4: 45,932,477 I1308V probably benign Het
Ccser1 T A 6: 61,422,952 probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Cntln G A 4: 85,049,674 R710K probably benign Het
Csn1s1 A T 5: 87,671,528 T15S possibly damaging Het
Cul9 T C 17: 46,543,372 T135A probably benign Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dhx38 G T 8: 109,562,720 probably benign Het
Dis3 A T 14: 99,098,815 I85N possibly damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dscaml1 A G 9: 45,750,132 D1776G probably damaging Het
Erbin A G 13: 103,830,316 S1209P probably benign Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Fbxo45 G T 16: 32,238,528 Q183K possibly damaging Het
Frmd4b C T 6: 97,412,487 probably null Het
Fzd7 A G 1: 59,484,202 S415G probably benign Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gstcd T C 3: 133,082,053 I295V probably benign Het
Gucy1a1 A G 3: 82,109,285 L132P possibly damaging Het
Il12b A C 11: 44,407,900 T61P probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Itih3 A C 14: 30,909,524 probably null Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Kif11 A G 19: 37,402,212 N408D probably benign Het
Kng2 TATGACCATGACCATGACCATGACCATGACCATGACCAT TATGACCATGACCATGACCATGACCATGACCAT 16: 22,987,953 probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Krt9 G T 11: 100,191,495 N201K probably damaging Het
Lmbr1 G A 5: 29,233,094 P304L probably benign Het
Lrrfip1 A G 1: 91,115,817 N648S probably benign Het
Mab21l3 C A 3: 101,815,153 V386L possibly damaging Het
Mamdc4 T C 2: 25,564,168 Q1149R probably benign Het
Mast1 A G 8: 84,920,366 F677L possibly damaging Het
Mcoln3 A G 3: 146,128,224 D173G probably benign Het
Mmrn1 C T 6: 60,944,805 T82I probably benign Het
Muc5ac A G 7: 141,792,035 T203A probably benign Het
Myo9b T C 8: 71,359,690 I2035T possibly damaging Het
Ndst3 T C 3: 123,671,885 N146S probably damaging Het
Neu4 A G 1: 94,022,450 T21A possibly damaging Het
Nos1ap G A 1: 170,327,646 L267F probably damaging Het
Olfr1208 A G 2: 88,896,761 F279L probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr399 A T 11: 74,053,993 Y255* probably null Het
Phc1 T C 6: 122,333,340 N136S probably damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Psd2 A G 18: 36,006,691 D596G possibly damaging Het
Psmc3 T C 2: 91,058,088 F315L probably benign Het
Rerg G A 6: 137,057,880 T42I probably benign Het
Rif1 T A 2: 52,093,576 M577K probably damaging Het
Sap30 T C 8: 57,487,248 probably null Het
Scn2b T C 9: 45,125,517 Y108H probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb2 T C 1: 107,523,813 V232A probably damaging Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Slc27a4 T C 2: 29,810,941 W320R probably damaging Het
Soga1 C T 2: 157,022,827 G1154S probably benign Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thbs4 T A 13: 92,790,879 D34V probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem56 T G 3: 121,207,421 I188L probably benign Het
Tmod2 T C 9: 75,577,242 E248G probably benign Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ttn T C 2: 76,785,538 D8360G possibly damaging Het
Unc80 A G 1: 66,640,552 E2094G possibly damaging Het
Vmn2r18 A T 5: 151,584,695 D321E probably damaging Het
Other mutations in Gpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Gpd2 APN 2 57268084 critical splice donor site probably null
IGL01012:Gpd2 APN 2 57364530 missense probably benign 0.00
IGL01096:Gpd2 APN 2 57338867 missense probably damaging 0.98
IGL01642:Gpd2 APN 2 57268071 nonsense probably null
IGL01816:Gpd2 APN 2 57364066 nonsense probably null
IGL02257:Gpd2 APN 2 57364524 missense probably benign 0.01
IGL02824:Gpd2 APN 2 57364327 missense probably null 0.89
IGL02832:Gpd2 APN 2 57338979 missense probably damaging 1.00
IGL03040:Gpd2 APN 2 57355793 missense probably benign 0.06
IGL03107:Gpd2 APN 2 57355569 missense probably damaging 1.00
IGL03131:Gpd2 APN 2 57338843 splice site probably benign
IGL03218:Gpd2 APN 2 57307054 missense probably damaging 1.00
IGL03226:Gpd2 APN 2 57304486 critical splice donor site probably null
IGL03372:Gpd2 APN 2 57355507 missense probably damaging 1.00
kraft UTSW 2 57304396 missense probably damaging 0.96
R0012:Gpd2 UTSW 2 57338868 missense probably damaging 1.00
R0285:Gpd2 UTSW 2 57338955 missense probably benign 0.16
R0379:Gpd2 UTSW 2 57345263 missense probably damaging 1.00
R0401:Gpd2 UTSW 2 57340093 missense possibly damaging 0.94
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1490:Gpd2 UTSW 2 57355475 missense probably damaging 1.00
R1672:Gpd2 UTSW 2 57357700 missense probably damaging 0.97
R1709:Gpd2 UTSW 2 57357655 missense probably damaging 1.00
R1735:Gpd2 UTSW 2 57355551 missense probably damaging 1.00
R2959:Gpd2 UTSW 2 57338975 nonsense probably null
R2960:Gpd2 UTSW 2 57338975 nonsense probably null
R2961:Gpd2 UTSW 2 57338975 nonsense probably null
R2962:Gpd2 UTSW 2 57338975 nonsense probably null
R3008:Gpd2 UTSW 2 57338975 nonsense probably null
R3009:Gpd2 UTSW 2 57338975 nonsense probably null
R3881:Gpd2 UTSW 2 57338975 nonsense probably null
R4073:Gpd2 UTSW 2 57290013 missense probably damaging 1.00
R4153:Gpd2 UTSW 2 57355771 missense probably damaging 1.00
R4564:Gpd2 UTSW 2 57307083 missense possibly damaging 0.77
R4952:Gpd2 UTSW 2 57307013 nonsense probably null
R5030:Gpd2 UTSW 2 57304405 missense probably damaging 0.98
R5101:Gpd2 UTSW 2 57355901 missense probably damaging 1.00
R5185:Gpd2 UTSW 2 57340204 missense probably damaging 1.00
R6020:Gpd2 UTSW 2 57364513 missense probably benign 0.18
R6325:Gpd2 UTSW 2 57304396 missense probably damaging 0.96
R6536:Gpd2 UTSW 2 57345355 missense probably benign 0.40
R6923:Gpd2 UTSW 2 57355788 missense probably damaging 0.98
R7058:Gpd2 UTSW 2 57307100 splice site probably null
R7380:Gpd2 UTSW 2 57340159 missense probably damaging 1.00
R8052:Gpd2 UTSW 2 57306950 nonsense probably null
R8098:Gpd2 UTSW 2 57290008 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGACACACTTCTGTACCACC -3'
(R):5'- AAATTGGCAAGTCCCACAAGG -3'

Sequencing Primer
(F):5'- TGTACCACCCGTCCGTG -3'
(R):5'- AGGGTGACAGACAAATCC -3'
Posted On2014-09-17