Incidental Mutation 'R2056:Psmc3'
ID228161
Institutional Source Beutler Lab
Gene Symbol Psmc3
Ensembl Gene ENSMUSG00000002102
Gene Nameproteasome (prosome, macropain) 26S subunit, ATPase 3
SynonymsTat binding protein 1, TBP-1
MMRRC Submission 040061-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2056 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91054009-91066369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91058088 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 315 (F315L)
Ref Sequence ENSEMBL: ENSMUSP00000107068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002171] [ENSMUST00000067663] [ENSMUST00000073575] [ENSMUST00000079976] [ENSMUST00000111436] [ENSMUST00000111441] [ENSMUST00000185715]
Predicted Effect probably benign
Transcript: ENSMUST00000002171
AA Change: F357L

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000002171
Gene: ENSMUSG00000002102
AA Change: F357L

DomainStartEndE-ValueType
AAA 222 361 6.65e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067663
AA Change: F357L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071054
Gene: ENSMUSG00000002102
AA Change: F357L

DomainStartEndE-ValueType
AAA 222 361 6.65e-22 SMART
Blast:AAA 390 436 9e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073575
SMART Domains Protein: ENSMUSP00000073263
Gene: ENSMUSG00000002105

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Zip 65 357 5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079976
SMART Domains Protein: ENSMUSP00000078892
Gene: ENSMUSG00000002105

DomainStartEndE-ValueType
Pfam:Zip 3 156 3.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111436
SMART Domains Protein: ENSMUSP00000107063
Gene: ENSMUSG00000002105

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Zip 65 214 2.4e-14 PFAM
Pfam:Zip 206 370 5.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111441
AA Change: F315L

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107068
Gene: ENSMUSG00000002102
AA Change: F315L

DomainStartEndE-ValueType
AAA 180 319 6.65e-22 SMART
Blast:AAA 348 394 8e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145317
Predicted Effect probably benign
Transcript: ENSMUST00000146506
SMART Domains Protein: ENSMUSP00000121688
Gene: ENSMUSG00000002102

DomainStartEndE-ValueType
PDB:4CR4|M 13 183 2e-69 PDB
Blast:AAA 140 183 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151419
Predicted Effect probably benign
Transcript: ENSMUST00000185715
SMART Domains Protein: ENSMUSP00000139782
Gene: ENSMUSG00000002102

DomainStartEndE-ValueType
AAA 203 301 9e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,573,745 R575G possibly damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adh1 A G 3: 138,286,915 D264G probably damaging Het
Ahnak2 T A 12: 112,785,006 D407V probably benign Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ankmy1 T C 1: 92,881,831 I662V possibly damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apc A G 18: 34,316,428 R2092G probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Brap G A 5: 121,663,466 G95S probably damaging Het
Cbfa2t2 G A 2: 154,535,157 A587T probably damaging Het
Ccdc180 A G 4: 45,932,477 I1308V probably benign Het
Ccser1 T A 6: 61,422,952 probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Cntln G A 4: 85,049,674 R710K probably benign Het
Csn1s1 A T 5: 87,671,528 T15S possibly damaging Het
Cul9 T C 17: 46,543,372 T135A probably benign Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dhx38 G T 8: 109,562,720 probably benign Het
Dis3 A T 14: 99,098,815 I85N possibly damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dscaml1 A G 9: 45,750,132 D1776G probably damaging Het
Erbin A G 13: 103,830,316 S1209P probably benign Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Fbxo45 G T 16: 32,238,528 Q183K possibly damaging Het
Frmd4b C T 6: 97,412,487 probably null Het
Fzd7 A G 1: 59,484,202 S415G probably benign Het
Gpd2 T A 2: 57,339,013 probably null Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gstcd T C 3: 133,082,053 I295V probably benign Het
Gucy1a1 A G 3: 82,109,285 L132P possibly damaging Het
Il12b A C 11: 44,407,900 T61P probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Itih3 A C 14: 30,909,524 probably null Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Kif11 A G 19: 37,402,212 N408D probably benign Het
Kng2 TATGACCATGACCATGACCATGACCATGACCATGACCAT TATGACCATGACCATGACCATGACCATGACCAT 16: 22,987,953 probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Krt9 G T 11: 100,191,495 N201K probably damaging Het
Lmbr1 G A 5: 29,233,094 P304L probably benign Het
Lrrfip1 A G 1: 91,115,817 N648S probably benign Het
Mab21l3 C A 3: 101,815,153 V386L possibly damaging Het
Mamdc4 T C 2: 25,564,168 Q1149R probably benign Het
Mast1 A G 8: 84,920,366 F677L possibly damaging Het
Mcoln3 A G 3: 146,128,224 D173G probably benign Het
Mmrn1 C T 6: 60,944,805 T82I probably benign Het
Muc5ac A G 7: 141,792,035 T203A probably benign Het
Myo9b T C 8: 71,359,690 I2035T possibly damaging Het
Ndst3 T C 3: 123,671,885 N146S probably damaging Het
Neu4 A G 1: 94,022,450 T21A possibly damaging Het
Nos1ap G A 1: 170,327,646 L267F probably damaging Het
Olfr1208 A G 2: 88,896,761 F279L probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr399 A T 11: 74,053,993 Y255* probably null Het
Phc1 T C 6: 122,333,340 N136S probably damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Psd2 A G 18: 36,006,691 D596G possibly damaging Het
Rerg G A 6: 137,057,880 T42I probably benign Het
Rif1 T A 2: 52,093,576 M577K probably damaging Het
Sap30 T C 8: 57,487,248 probably null Het
Scn2b T C 9: 45,125,517 Y108H probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb2 T C 1: 107,523,813 V232A probably damaging Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Slc27a4 T C 2: 29,810,941 W320R probably damaging Het
Soga1 C T 2: 157,022,827 G1154S probably benign Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thbs4 T A 13: 92,790,879 D34V probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem56 T G 3: 121,207,421 I188L probably benign Het
Tmod2 T C 9: 75,577,242 E248G probably benign Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ttn T C 2: 76,785,538 D8360G possibly damaging Het
Unc80 A G 1: 66,640,552 E2094G possibly damaging Het
Vmn2r18 A T 5: 151,584,695 D321E probably damaging Het
Other mutations in Psmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0370:Psmc3 UTSW 2 91055118 splice site probably null
R0747:Psmc3 UTSW 2 91054300 missense probably benign 0.10
R1182:Psmc3 UTSW 2 91056035 missense probably damaging 1.00
R1763:Psmc3 UTSW 2 91055995 missense possibly damaging 0.81
R1967:Psmc3 UTSW 2 91057844 missense probably benign 0.19
R2484:Psmc3 UTSW 2 91056001 missense probably damaging 0.97
R3411:Psmc3 UTSW 2 91055918 missense probably damaging 1.00
R3608:Psmc3 UTSW 2 91054580 missense probably benign 0.00
R4917:Psmc3 UTSW 2 91065972 unclassified probably benign
R4954:Psmc3 UTSW 2 91055629 intron probably benign
R5033:Psmc3 UTSW 2 91054608 missense probably benign 0.03
R5073:Psmc3 UTSW 2 91054570 splice site probably benign
R5279:Psmc3 UTSW 2 91054322 missense probably benign
R5354:Psmc3 UTSW 2 91059353 missense probably damaging 1.00
R6169:Psmc3 UTSW 2 91057839 missense probably damaging 1.00
R6224:Psmc3 UTSW 2 91054630 missense probably damaging 1.00
R7039:Psmc3 UTSW 2 91055046 missense probably benign 0.32
R7275:Psmc3 UTSW 2 91055930 missense probably damaging 0.97
R7962:Psmc3 UTSW 2 91056662 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGTCTCAGGACTGACAGCTC -3'
(R):5'- GAAATGGAGGCTATGTGCATGC -3'

Sequencing Primer
(F):5'- GGCTCTGCCTTCCCCATTC -3'
(R):5'- CCAGCTTGGTCTACAAAGTGAGTTC -3'
Posted On2014-09-17