Incidental Mutation 'R2056:Fat4'
ID 228166
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene Name FAT atypical cadherin 4
Synonyms 6030410K14Rik
MMRRC Submission 040061-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2056 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 38941089-39066134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38945319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1404 (M1404K)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061260
AA Change: M1404K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: M1404K

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153659
Meta Mutation Damage Score 0.1733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T C 6: 58,667,525 (GRCm39) V129A probably benign Het
Adh1 A G 3: 137,992,676 (GRCm39) D264G probably damaging Het
Ahnak2 T A 12: 112,748,626 (GRCm39) D407V probably benign Het
Alas1 T C 9: 106,118,489 (GRCm39) E211G probably damaging Het
Alkbh1 C T 12: 87,490,520 (GRCm39) probably benign Het
Ankmy1 T C 1: 92,809,553 (GRCm39) I662V possibly damaging Het
Ano1 A G 7: 144,201,789 (GRCm39) V334A probably damaging Het
Apc A G 18: 34,449,481 (GRCm39) R2092G probably damaging Het
Arhgap18 C T 10: 26,730,904 (GRCm39) T122I probably benign Het
Atp2b4 G T 1: 133,654,275 (GRCm39) Q777K probably benign Het
Brap G A 5: 121,801,529 (GRCm39) G95S probably damaging Het
Cbfa2t2 G A 2: 154,377,077 (GRCm39) A587T probably damaging Het
Ccdc180 A G 4: 45,932,477 (GRCm39) I1308V probably benign Het
Ccser1 T A 6: 61,399,936 (GRCm39) probably null Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Cmtm4 A C 8: 105,081,920 (GRCm39) F156V probably damaging Het
Cntln G A 4: 84,967,911 (GRCm39) R710K probably benign Het
Csn1s1 A T 5: 87,819,387 (GRCm39) T15S possibly damaging Het
Cul9 T C 17: 46,854,298 (GRCm39) T135A probably benign Het
Cyp2d10 T A 15: 82,288,015 (GRCm39) I363F probably damaging Het
Dhx38 G T 8: 110,289,352 (GRCm39) probably benign Het
Dis3 A T 14: 99,336,251 (GRCm39) I85N possibly damaging Het
Dmbt1 G A 7: 130,707,900 (GRCm39) A1381T possibly damaging Het
Dscaml1 A G 9: 45,661,430 (GRCm39) D1776G probably damaging Het
Erbin A G 13: 103,966,824 (GRCm39) S1209P probably benign Het
Fbxo45 G T 16: 32,057,346 (GRCm39) Q183K possibly damaging Het
Frmd4b C T 6: 97,389,448 (GRCm39) probably null Het
Fzd7 A G 1: 59,523,361 (GRCm39) S415G probably benign Het
Gpd2 T A 2: 57,229,025 (GRCm39) probably null Het
Gsk3b T A 16: 38,008,271 (GRCm39) D192E probably benign Het
Gstcd T C 3: 132,787,814 (GRCm39) I295V probably benign Het
Gucy1a1 A G 3: 82,016,592 (GRCm39) L132P possibly damaging Het
Il12b A C 11: 44,298,727 (GRCm39) T61P probably damaging Het
Il7 A T 3: 7,638,975 (GRCm39) N130K probably damaging Het
Itih3 A C 14: 30,631,481 (GRCm39) probably null Het
Kdm5b T A 1: 134,540,952 (GRCm39) D681E probably benign Het
Kif11 A G 19: 37,390,660 (GRCm39) N408D probably benign Het
Kng2 TATGACCATGACCATGACCATGACCATGACCATGACCAT TATGACCATGACCATGACCATGACCATGACCAT 16: 22,806,703 (GRCm39) probably benign Het
Kremen2 T C 17: 23,961,691 (GRCm39) E272G possibly damaging Het
Krt9 G T 11: 100,082,321 (GRCm39) N201K probably damaging Het
Lmbr1 G A 5: 29,438,092 (GRCm39) P304L probably benign Het
Lrrfip1 A G 1: 91,043,539 (GRCm39) N648S probably benign Het
Mab21l3 C A 3: 101,722,469 (GRCm39) V386L possibly damaging Het
Mamdc4 T C 2: 25,454,180 (GRCm39) Q1149R probably benign Het
Mast1 A G 8: 85,646,995 (GRCm39) F677L possibly damaging Het
Mcoln3 A G 3: 145,833,979 (GRCm39) D173G probably benign Het
Mmrn1 C T 6: 60,921,789 (GRCm39) T82I probably benign Het
Mtcl2 C T 2: 156,864,747 (GRCm39) G1154S probably benign Het
Muc5ac A G 7: 141,345,772 (GRCm39) T203A probably benign Het
Myo9b T C 8: 71,812,334 (GRCm39) I2035T possibly damaging Het
Ndst3 T C 3: 123,465,534 (GRCm39) N146S probably damaging Het
Neu4 A G 1: 93,950,172 (GRCm39) T21A possibly damaging Het
Nos1ap G A 1: 170,155,215 (GRCm39) L267F probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or3a4 A T 11: 73,944,819 (GRCm39) Y255* probably null Het
Or4p8 A G 2: 88,727,105 (GRCm39) F279L probably damaging Het
Phc1 T C 6: 122,310,299 (GRCm39) N136S probably damaging Het
Prkdc A G 16: 15,545,469 (GRCm39) T1862A probably benign Het
Psd2 A G 18: 36,139,744 (GRCm39) D596G possibly damaging Het
Psmc3 T C 2: 90,888,433 (GRCm39) F315L probably benign Het
Rerg G A 6: 137,034,878 (GRCm39) T42I probably benign Het
Rif1 T A 2: 51,983,588 (GRCm39) M577K probably damaging Het
Sap30 T C 8: 57,940,282 (GRCm39) probably null Het
Scn2b T C 9: 45,036,815 (GRCm39) Y108H probably damaging Het
Senp2 C T 16: 21,832,949 (GRCm39) T79I probably damaging Het
Serpinb2 T C 1: 107,451,543 (GRCm39) V232A probably damaging Het
Sgpp2 T A 1: 78,393,588 (GRCm39) L197Q probably damaging Het
Slc27a4 T C 2: 29,700,953 (GRCm39) W320R probably damaging Het
Spmip4 T C 6: 50,550,725 (GRCm39) R575G possibly damaging Het
Tgm4 T C 9: 122,890,835 (GRCm39) I54T probably damaging Het
Thbs4 T A 13: 92,927,387 (GRCm39) D34V probably benign Het
Tlcd4 T G 3: 121,001,070 (GRCm39) I188L probably benign Het
Tmem176b G A 6: 48,813,267 (GRCm39) T64I probably damaging Het
Tmod2 T C 9: 75,484,524 (GRCm39) E248G probably benign Het
Ttc6 T A 12: 57,784,479 (GRCm39) D1849E probably benign Het
Ttn T C 2: 76,615,882 (GRCm39) D8360G possibly damaging Het
Unc80 A G 1: 66,679,711 (GRCm39) E2094G possibly damaging Het
Vmn2r18 A T 5: 151,508,160 (GRCm39) D321E probably damaging Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 39,036,398 (GRCm39) missense probably damaging 1.00
IGL00509:Fat4 APN 3 38,943,188 (GRCm39) missense probably damaging 1.00
IGL00698:Fat4 APN 3 39,035,294 (GRCm39) missense probably benign 0.17
IGL00934:Fat4 APN 3 38,944,822 (GRCm39) missense probably damaging 1.00
IGL01063:Fat4 APN 3 38,944,728 (GRCm39) missense possibly damaging 0.80
IGL01123:Fat4 APN 3 39,011,418 (GRCm39) missense probably benign 0.00
IGL01313:Fat4 APN 3 39,061,350 (GRCm39) missense possibly damaging 0.53
IGL01328:Fat4 APN 3 39,034,807 (GRCm39) missense probably damaging 1.00
IGL01328:Fat4 APN 3 38,944,140 (GRCm39) missense probably damaging 1.00
IGL01374:Fat4 APN 3 38,941,647 (GRCm39) missense probably damaging 1.00
IGL01412:Fat4 APN 3 38,945,330 (GRCm39) missense probably benign 0.09
IGL01472:Fat4 APN 3 38,942,219 (GRCm39) missense probably damaging 1.00
IGL01514:Fat4 APN 3 39,003,683 (GRCm39) missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39,063,406 (GRCm39) missense probably damaging 1.00
IGL01548:Fat4 APN 3 38,941,907 (GRCm39) missense probably damaging 0.99
IGL01576:Fat4 APN 3 38,943,096 (GRCm39) missense probably damaging 1.00
IGL01591:Fat4 APN 3 39,064,524 (GRCm39) nonsense probably null
IGL01626:Fat4 APN 3 39,005,181 (GRCm39) missense probably damaging 1.00
IGL01746:Fat4 APN 3 39,045,880 (GRCm39) nonsense probably null
IGL01800:Fat4 APN 3 39,035,878 (GRCm39) missense probably damaging 0.99
IGL01815:Fat4 APN 3 38,942,922 (GRCm39) missense probably damaging 1.00
IGL01863:Fat4 APN 3 39,024,768 (GRCm39) splice site probably benign
IGL01917:Fat4 APN 3 38,943,879 (GRCm39) missense possibly damaging 0.89
IGL01936:Fat4 APN 3 39,033,923 (GRCm39) missense probably benign 0.10
IGL02060:Fat4 APN 3 39,064,420 (GRCm39) missense probably damaging 1.00
IGL02103:Fat4 APN 3 38,943,348 (GRCm39) missense probably damaging 0.97
IGL02119:Fat4 APN 3 39,037,088 (GRCm39) missense probably benign 0.10
IGL02124:Fat4 APN 3 38,942,553 (GRCm39) missense probably damaging 1.00
IGL02164:Fat4 APN 3 39,050,354 (GRCm39) critical splice donor site probably null
IGL02182:Fat4 APN 3 38,944,695 (GRCm39) missense probably damaging 1.00
IGL02207:Fat4 APN 3 39,005,412 (GRCm39) missense probably benign 0.16
IGL02210:Fat4 APN 3 38,946,002 (GRCm39) missense probably benign 0.01
IGL02257:Fat4 APN 3 39,055,288 (GRCm39) missense probably benign 0.09
IGL02271:Fat4 APN 3 39,034,068 (GRCm39) missense probably benign 0.18
IGL02305:Fat4 APN 3 39,064,137 (GRCm39) missense probably damaging 1.00
IGL02314:Fat4 APN 3 38,941,779 (GRCm39) missense probably damaging 1.00
IGL02455:Fat4 APN 3 39,005,280 (GRCm39) missense possibly damaging 0.48
IGL02468:Fat4 APN 3 39,037,195 (GRCm39) missense probably benign
IGL02478:Fat4 APN 3 38,942,364 (GRCm39) missense probably damaging 1.00
IGL02480:Fat4 APN 3 39,064,579 (GRCm39) missense probably damaging 1.00
IGL02487:Fat4 APN 3 38,941,394 (GRCm39) missense probably damaging 1.00
IGL02632:Fat4 APN 3 39,056,913 (GRCm39) missense probably benign 0.04
IGL02665:Fat4 APN 3 39,056,985 (GRCm39) missense probably benign 0.08
IGL02674:Fat4 APN 3 39,037,486 (GRCm39) missense probably benign 0.35
IGL02692:Fat4 APN 3 39,005,235 (GRCm39) missense probably damaging 1.00
IGL02710:Fat4 APN 3 38,944,744 (GRCm39) missense probably damaging 1.00
IGL02803:Fat4 APN 3 38,943,444 (GRCm39) missense probably damaging 1.00
IGL02834:Fat4 APN 3 39,010,893 (GRCm39) missense probably damaging 1.00
IGL02891:Fat4 APN 3 39,005,422 (GRCm39) missense probably damaging 1.00
IGL02982:Fat4 APN 3 38,944,992 (GRCm39) missense probably damaging 1.00
IGL02993:Fat4 APN 3 39,011,304 (GRCm39) missense probably damaging 1.00
IGL02996:Fat4 APN 3 39,012,674 (GRCm39) missense probably damaging 1.00
IGL03029:Fat4 APN 3 39,036,740 (GRCm39) missense possibly damaging 0.46
IGL03124:Fat4 APN 3 39,035,701 (GRCm39) missense possibly damaging 0.61
IGL03144:Fat4 APN 3 39,011,008 (GRCm39) missense possibly damaging 0.68
IGL03149:Fat4 APN 3 39,045,834 (GRCm39) missense probably damaging 1.00
IGL03169:Fat4 APN 3 39,011,547 (GRCm39) missense probably benign 0.02
IGL03190:Fat4 APN 3 39,035,390 (GRCm39) missense probably damaging 1.00
IGL03272:Fat4 APN 3 39,063,852 (GRCm39) missense probably benign
IGL03371:Fat4 APN 3 39,037,336 (GRCm39) missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38,943,283 (GRCm39) missense possibly damaging 0.88
IGL03388:Fat4 APN 3 39,011,376 (GRCm39) missense probably damaging 1.00
IGL03394:Fat4 APN 3 38,946,168 (GRCm39) missense probably damaging 0.99
IGL03394:Fat4 APN 3 39,063,513 (GRCm39) missense probably damaging 1.00
IGL03405:Fat4 APN 3 39,012,599 (GRCm39) missense probably benign 0.02
IGL03410:Fat4 APN 3 38,945,325 (GRCm39) missense probably damaging 1.00
Asahi UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
Expulsion UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
heineken UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
schlitz UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 39,036,506 (GRCm39) missense probably damaging 0.98
PIT4696001:Fat4 UTSW 3 38,943,153 (GRCm39) missense probably benign 0.04
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0078:Fat4 UTSW 3 38,943,080 (GRCm39) missense probably benign 0.35
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0201:Fat4 UTSW 3 38,945,745 (GRCm39) missense probably damaging 0.99
R0280:Fat4 UTSW 3 38,944,965 (GRCm39) missense probably benign
R0357:Fat4 UTSW 3 38,945,376 (GRCm39) missense probably damaging 1.00
R0409:Fat4 UTSW 3 39,031,562 (GRCm39) missense probably damaging 1.00
R0498:Fat4 UTSW 3 39,034,786 (GRCm39) missense probably benign 0.00
R0502:Fat4 UTSW 3 39,057,073 (GRCm39) missense probably damaging 0.98
R0506:Fat4 UTSW 3 38,942,463 (GRCm39) missense probably benign 0.00
R0532:Fat4 UTSW 3 39,035,870 (GRCm39) missense probably benign 0.02
R0616:Fat4 UTSW 3 38,997,019 (GRCm39) missense probably damaging 1.00
R0630:Fat4 UTSW 3 39,054,321 (GRCm39) missense probably damaging 1.00
R0678:Fat4 UTSW 3 38,943,843 (GRCm39) missense probably damaging 1.00
R0685:Fat4 UTSW 3 39,055,327 (GRCm39) missense probably benign
R0729:Fat4 UTSW 3 39,054,444 (GRCm39) splice site probably benign
R0748:Fat4 UTSW 3 38,941,977 (GRCm39) missense possibly damaging 0.67
R0811:Fat4 UTSW 3 39,011,623 (GRCm39) missense probably damaging 1.00
R0812:Fat4 UTSW 3 39,011,623 (GRCm39) missense probably damaging 1.00
R0830:Fat4 UTSW 3 39,053,258 (GRCm39) missense probably benign 0.26
R0841:Fat4 UTSW 3 39,050,147 (GRCm39) missense probably damaging 0.99
R0884:Fat4 UTSW 3 39,037,007 (GRCm39) missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38,945,541 (GRCm39) missense probably damaging 1.00
R1066:Fat4 UTSW 3 39,011,376 (GRCm39) missense probably damaging 1.00
R1078:Fat4 UTSW 3 39,037,235 (GRCm39) missense probably benign 0.10
R1084:Fat4 UTSW 3 39,033,974 (GRCm39) missense possibly damaging 0.88
R1118:Fat4 UTSW 3 39,037,091 (GRCm39) missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38,944,520 (GRCm39) missense probably benign 0.01
R1418:Fat4 UTSW 3 38,944,962 (GRCm39) missense probably damaging 1.00
R1475:Fat4 UTSW 3 38,942,472 (GRCm39) missense probably damaging 1.00
R1487:Fat4 UTSW 3 39,050,066 (GRCm39) missense possibly damaging 0.77
R1511:Fat4 UTSW 3 39,037,225 (GRCm39) missense probably damaging 0.97
R1534:Fat4 UTSW 3 38,944,238 (GRCm39) missense probably damaging 1.00
R1558:Fat4 UTSW 3 38,943,135 (GRCm39) missense probably damaging 1.00
R1586:Fat4 UTSW 3 38,943,009 (GRCm39) missense probably damaging 1.00
R1592:Fat4 UTSW 3 39,061,326 (GRCm39) missense probably damaging 0.99
R1655:Fat4 UTSW 3 39,011,467 (GRCm39) missense probably damaging 0.97
R1662:Fat4 UTSW 3 39,034,928 (GRCm39) missense probably damaging 1.00
R1710:Fat4 UTSW 3 39,005,304 (GRCm39) missense probably damaging 1.00
R1731:Fat4 UTSW 3 38,945,459 (GRCm39) missense probably damaging 1.00
R1761:Fat4 UTSW 3 38,941,638 (GRCm39) missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39,064,417 (GRCm39) missense probably damaging 1.00
R1828:Fat4 UTSW 3 39,037,607 (GRCm39) missense probably damaging 1.00
R1835:Fat4 UTSW 3 39,037,720 (GRCm39) missense probably benign 0.00
R1846:Fat4 UTSW 3 39,036,532 (GRCm39) missense probably benign 0.00
R1861:Fat4 UTSW 3 39,064,633 (GRCm39) missense probably benign 0.09
R1871:Fat4 UTSW 3 39,035,221 (GRCm39) missense possibly damaging 0.63
R1981:Fat4 UTSW 3 39,045,813 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 39,050,239 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 38,941,264 (GRCm39) missense probably benign
R2058:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39,064,804 (GRCm39) missense probably benign 0.00
R2078:Fat4 UTSW 3 38,943,822 (GRCm39) missense probably damaging 1.00
R2114:Fat4 UTSW 3 39,035,633 (GRCm39) missense probably benign 0.01
R2135:Fat4 UTSW 3 39,034,882 (GRCm39) missense probably damaging 0.98
R2152:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2153:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2154:Fat4 UTSW 3 38,941,688 (GRCm39) missense probably damaging 1.00
R2196:Fat4 UTSW 3 39,035,566 (GRCm39) missense probably benign 0.23
R2211:Fat4 UTSW 3 38,945,676 (GRCm39) missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39,064,364 (GRCm39) missense probably damaging 1.00
R2247:Fat4 UTSW 3 38,946,198 (GRCm39) missense probably damaging 1.00
R2263:Fat4 UTSW 3 38,943,138 (GRCm39) missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38,944,571 (GRCm39) missense probably benign 0.25
R2274:Fat4 UTSW 3 39,050,048 (GRCm39) missense possibly damaging 0.47
R2337:Fat4 UTSW 3 39,034,160 (GRCm39) missense probably damaging 1.00
R2343:Fat4 UTSW 3 39,011,254 (GRCm39) missense probably damaging 0.97
R2365:Fat4 UTSW 3 39,034,568 (GRCm39) missense probably benign
R2412:Fat4 UTSW 3 39,011,221 (GRCm39) missense probably benign 0.05
R2883:Fat4 UTSW 3 39,034,953 (GRCm39) missense probably damaging 1.00
R2942:Fat4 UTSW 3 39,036,485 (GRCm39) missense probably damaging 1.00
R2989:Fat4 UTSW 3 39,061,302 (GRCm39) missense probably benign
R3103:Fat4 UTSW 3 38,946,089 (GRCm39) missense probably benign 0.03
R3158:Fat4 UTSW 3 38,944,940 (GRCm39) missense possibly damaging 0.87
R3800:Fat4 UTSW 3 39,035,423 (GRCm39) missense possibly damaging 0.48
R3808:Fat4 UTSW 3 39,036,587 (GRCm39) missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3850:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3957:Fat4 UTSW 3 39,036,495 (GRCm39) missense probably benign
R4065:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign 0.13
R4078:Fat4 UTSW 3 39,034,169 (GRCm39) missense probably damaging 1.00
R4096:Fat4 UTSW 3 38,942,024 (GRCm39) missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38,996,958 (GRCm39) missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R4285:Fat4 UTSW 3 38,943,320 (GRCm39) missense probably benign 0.00
R4288:Fat4 UTSW 3 38,945,912 (GRCm39) missense probably damaging 1.00
R4407:Fat4 UTSW 3 39,012,689 (GRCm39) missense probably benign 0.05
R4528:Fat4 UTSW 3 38,945,443 (GRCm39) missense probably benign 0.01
R4547:Fat4 UTSW 3 39,005,432 (GRCm39) missense probably damaging 1.00
R4681:Fat4 UTSW 3 38,941,491 (GRCm39) missense probably damaging 1.00
R4826:Fat4 UTSW 3 39,037,106 (GRCm39) missense probably damaging 1.00
R4855:Fat4 UTSW 3 38,942,466 (GRCm39) missense probably benign
R4871:Fat4 UTSW 3 38,945,754 (GRCm39) missense probably damaging 1.00
R4897:Fat4 UTSW 3 39,034,781 (GRCm39) missense probably damaging 1.00
R4928:Fat4 UTSW 3 39,064,614 (GRCm39) missense probably damaging 1.00
R4932:Fat4 UTSW 3 39,061,352 (GRCm39) missense probably benign 0.00
R4941:Fat4 UTSW 3 39,011,601 (GRCm39) missense probably damaging 1.00
R4943:Fat4 UTSW 3 39,034,322 (GRCm39) missense probably benign 0.19
R4959:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R4973:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R5098:Fat4 UTSW 3 38,942,438 (GRCm39) missense probably benign 0.34
R5163:Fat4 UTSW 3 39,034,946 (GRCm39) missense probably damaging 1.00
R5213:Fat4 UTSW 3 39,034,340 (GRCm39) missense possibly damaging 0.56
R5328:Fat4 UTSW 3 39,011,017 (GRCm39) missense probably damaging 1.00
R5337:Fat4 UTSW 3 39,064,527 (GRCm39) missense probably benign 0.44
R5337:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R5363:Fat4 UTSW 3 38,942,154 (GRCm39) missense probably damaging 1.00
R5380:Fat4 UTSW 3 38,943,013 (GRCm39) missense probably damaging 1.00
R5384:Fat4 UTSW 3 39,050,095 (GRCm39) missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38,941,394 (GRCm39) missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38,945,495 (GRCm39) missense probably benign 0.00
R5443:Fat4 UTSW 3 39,064,519 (GRCm39) missense probably damaging 1.00
R5501:Fat4 UTSW 3 38,941,364 (GRCm39) missense probably benign 0.09
R5571:Fat4 UTSW 3 39,064,423 (GRCm39) missense probably damaging 1.00
R5625:Fat4 UTSW 3 38,943,083 (GRCm39) missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39,057,117 (GRCm39) missense probably damaging 0.99
R5725:Fat4 UTSW 3 38,943,774 (GRCm39) missense probably damaging 1.00
R5735:Fat4 UTSW 3 39,003,725 (GRCm39) missense probably damaging 1.00
R5739:Fat4 UTSW 3 39,037,283 (GRCm39) missense probably benign 0.01
R5766:Fat4 UTSW 3 38,943,617 (GRCm39) missense probably damaging 1.00
R5780:Fat4 UTSW 3 39,035,104 (GRCm39) missense probably damaging 0.96
R5811:Fat4 UTSW 3 38,945,936 (GRCm39) missense probably damaging 1.00
R5829:Fat4 UTSW 3 39,061,454 (GRCm39) missense probably damaging 1.00
R5879:Fat4 UTSW 3 38,941,485 (GRCm39) missense probably benign
R5933:Fat4 UTSW 3 39,005,524 (GRCm39) critical splice donor site probably null
R5938:Fat4 UTSW 3 39,005,388 (GRCm39) missense probably damaging 1.00
R5940:Fat4 UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
R5945:Fat4 UTSW 3 39,037,355 (GRCm39) missense probably benign 0.19
R5963:Fat4 UTSW 3 39,064,696 (GRCm39) missense probably damaging 1.00
R6077:Fat4 UTSW 3 39,056,951 (GRCm39) missense probably damaging 1.00
R6158:Fat4 UTSW 3 39,037,411 (GRCm39) missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 1.00
R6253:Fat4 UTSW 3 39,005,505 (GRCm39) missense probably damaging 0.99
R6259:Fat4 UTSW 3 39,061,395 (GRCm39) missense probably benign 0.18
R6295:Fat4 UTSW 3 39,061,229 (GRCm39) splice site probably null
R6387:Fat4 UTSW 3 39,037,934 (GRCm39) missense probably damaging 1.00
R6390:Fat4 UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
R6456:Fat4 UTSW 3 39,038,128 (GRCm39) missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38,945,036 (GRCm39) missense probably damaging 1.00
R6500:Fat4 UTSW 3 39,035,418 (GRCm39) nonsense probably null
R6503:Fat4 UTSW 3 39,036,406 (GRCm39) missense probably benign 0.00
R6519:Fat4 UTSW 3 39,057,020 (GRCm39) missense probably benign
R6566:Fat4 UTSW 3 39,011,275 (GRCm39) missense possibly damaging 0.78
R6576:Fat4 UTSW 3 39,033,839 (GRCm39) missense probably benign
R6590:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6658:Fat4 UTSW 3 38,997,077 (GRCm39) missense probably benign 0.01
R6662:Fat4 UTSW 3 39,010,970 (GRCm39) missense possibly damaging 0.95
R6690:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6807:Fat4 UTSW 3 39,036,589 (GRCm39) missense probably benign 0.18
R6823:Fat4 UTSW 3 39,038,088 (GRCm39) missense probably benign 0.05
R6824:Fat4 UTSW 3 39,011,674 (GRCm39) missense probably benign 0.00
R6830:Fat4 UTSW 3 39,035,966 (GRCm39) missense probably benign 0.00
R6925:Fat4 UTSW 3 39,050,353 (GRCm39) critical splice donor site probably null
R6948:Fat4 UTSW 3 39,063,595 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,050,120 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,035,924 (GRCm39) missense probably damaging 1.00
R7017:Fat4 UTSW 3 38,945,692 (GRCm39) missense probably benign
R7030:Fat4 UTSW 3 39,036,107 (GRCm39) missense probably damaging 1.00
R7044:Fat4 UTSW 3 39,064,960 (GRCm39) missense probably benign 0.02
R7044:Fat4 UTSW 3 39,064,959 (GRCm39) missense probably benign
R7045:Fat4 UTSW 3 38,942,750 (GRCm39) missense probably benign 0.01
R7094:Fat4 UTSW 3 38,944,023 (GRCm39) missense probably damaging 1.00
R7111:Fat4 UTSW 3 39,064,682 (GRCm39) missense probably damaging 1.00
R7130:Fat4 UTSW 3 39,034,936 (GRCm39) missense probably damaging 0.99
R7168:Fat4 UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
R7192:Fat4 UTSW 3 39,034,613 (GRCm39) missense probably benign 0.04
R7194:Fat4 UTSW 3 39,038,044 (GRCm39) missense probably damaging 1.00
R7194:Fat4 UTSW 3 38,943,033 (GRCm39) missense probably damaging 1.00
R7199:Fat4 UTSW 3 39,031,511 (GRCm39) missense probably damaging 0.98
R7213:Fat4 UTSW 3 39,053,236 (GRCm39) missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38,945,192 (GRCm39) missense probably damaging 1.00
R7225:Fat4 UTSW 3 39,034,325 (GRCm39) missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38,944,562 (GRCm39) missense probably benign 0.31
R7239:Fat4 UTSW 3 39,037,989 (GRCm39) missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38,943,842 (GRCm39) missense probably damaging 1.00
R7296:Fat4 UTSW 3 38,943,294 (GRCm39) nonsense probably null
R7372:Fat4 UTSW 3 38,944,358 (GRCm39) missense probably damaging 1.00
R7400:Fat4 UTSW 3 38,942,073 (GRCm39) missense probably damaging 1.00
R7419:Fat4 UTSW 3 39,054,385 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 39,063,793 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 38,941,599 (GRCm39) missense probably damaging 0.97
R7431:Fat4 UTSW 3 39,063,306 (GRCm39) missense possibly damaging 0.80
R7486:Fat4 UTSW 3 39,011,576 (GRCm39) nonsense probably null
R7501:Fat4 UTSW 3 39,012,597 (GRCm39) nonsense probably null
R7533:Fat4 UTSW 3 39,061,406 (GRCm39) missense probably benign 0.43
R7542:Fat4 UTSW 3 39,035,770 (GRCm39) missense possibly damaging 0.64
R7542:Fat4 UTSW 3 39,035,504 (GRCm39) missense possibly damaging 0.56
R7548:Fat4 UTSW 3 39,035,263 (GRCm39) missense probably benign 0.13
R7567:Fat4 UTSW 3 38,943,485 (GRCm39) missense probably damaging 1.00
R7644:Fat4 UTSW 3 39,064,390 (GRCm39) missense possibly damaging 0.64
R7660:Fat4 UTSW 3 39,035,309 (GRCm39) missense probably benign
R7665:Fat4 UTSW 3 38,943,327 (GRCm39) missense probably benign 0.00
R7676:Fat4 UTSW 3 38,945,846 (GRCm39) missense probably damaging 0.98
R7832:Fat4 UTSW 3 39,055,353 (GRCm39) missense probably benign 0.00
R7848:Fat4 UTSW 3 38,942,000 (GRCm39) missense probably benign
R7883:Fat4 UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
R7892:Fat4 UTSW 3 39,003,588 (GRCm39) critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38,941,690 (GRCm39) missense probably damaging 1.00
R7952:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 0.98
R8015:Fat4 UTSW 3 39,036,065 (GRCm39) missense possibly damaging 0.79
R8040:Fat4 UTSW 3 39,035,815 (GRCm39) missense probably damaging 1.00
R8142:Fat4 UTSW 3 38,945,352 (GRCm39) missense probably damaging 1.00
R8151:Fat4 UTSW 3 38,946,203 (GRCm39) missense probably damaging 0.99
R8163:Fat4 UTSW 3 39,033,881 (GRCm39) missense possibly damaging 0.88
R8317:Fat4 UTSW 3 39,012,659 (GRCm39) missense possibly damaging 0.80
R8413:Fat4 UTSW 3 39,063,128 (GRCm39) critical splice acceptor site probably null
R8447:Fat4 UTSW 3 39,033,824 (GRCm39) missense possibly damaging 0.88
R8458:Fat4 UTSW 3 39,035,702 (GRCm39) missense probably benign 0.25
R8509:Fat4 UTSW 3 39,036,052 (GRCm39) missense probably benign
R8543:Fat4 UTSW 3 39,031,643 (GRCm39) missense probably damaging 1.00
R8679:Fat4 UTSW 3 39,064,842 (GRCm39) missense probably damaging 1.00
R8726:Fat4 UTSW 3 39,064,647 (GRCm39) missense probably damaging 1.00
R8743:Fat4 UTSW 3 38,942,592 (GRCm39) missense probably benign 0.16
R8751:Fat4 UTSW 3 38,946,002 (GRCm39) missense probably benign 0.01
R8779:Fat4 UTSW 3 39,033,898 (GRCm39) missense probably damaging 1.00
R8797:Fat4 UTSW 3 39,053,278 (GRCm39) missense probably benign 0.01
R8860:Fat4 UTSW 3 38,946,269 (GRCm39) missense probably benign 0.26
R8955:Fat4 UTSW 3 39,037,778 (GRCm39) missense probably benign 0.01
R9053:Fat4 UTSW 3 38,941,324 (GRCm39) nonsense probably null
R9071:Fat4 UTSW 3 39,037,598 (GRCm39) missense probably benign 0.29
R9088:Fat4 UTSW 3 39,061,448 (GRCm39) missense probably benign 0.02
R9100:Fat4 UTSW 3 39,064,803 (GRCm39) missense
R9180:Fat4 UTSW 3 38,942,556 (GRCm39) missense possibly damaging 0.78
R9184:Fat4 UTSW 3 39,036,592 (GRCm39) missense probably damaging 0.99
R9201:Fat4 UTSW 3 38,945,079 (GRCm39) missense probably damaging 1.00
R9206:Fat4 UTSW 3 39,063,390 (GRCm39) missense probably damaging 0.99
R9268:Fat4 UTSW 3 38,942,396 (GRCm39) missense probably damaging 1.00
R9278:Fat4 UTSW 3 38,945,171 (GRCm39) missense probably benign 0.44
R9287:Fat4 UTSW 3 38,945,781 (GRCm39) missense probably damaging 0.98
R9355:Fat4 UTSW 3 39,036,047 (GRCm39) missense probably damaging 1.00
R9437:Fat4 UTSW 3 38,945,417 (GRCm39) missense probably benign 0.00
R9455:Fat4 UTSW 3 38,945,412 (GRCm39) missense
R9456:Fat4 UTSW 3 38,942,571 (GRCm39) missense possibly damaging 0.50
R9476:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9510:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9511:Fat4 UTSW 3 39,034,802 (GRCm39) missense probably damaging 0.98
R9540:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign
R9568:Fat4 UTSW 3 38,946,156 (GRCm39) missense probably damaging 1.00
R9646:Fat4 UTSW 3 39,035,813 (GRCm39) missense probably damaging 1.00
R9683:Fat4 UTSW 3 38,943,332 (GRCm39) missense possibly damaging 0.52
R9711:Fat4 UTSW 3 39,055,374 (GRCm39) missense probably benign 0.00
X0017:Fat4 UTSW 3 39,063,255 (GRCm39) missense probably benign 0.00
X0019:Fat4 UTSW 3 39,035,189 (GRCm39) missense probably damaging 1.00
X0020:Fat4 UTSW 3 39,054,300 (GRCm39) missense probably damaging 1.00
X0024:Fat4 UTSW 3 38,997,051 (GRCm39) missense probably benign 0.43
X0064:Fat4 UTSW 3 39,024,901 (GRCm39) missense probably damaging 1.00
Z1088:Fat4 UTSW 3 39,012,641 (GRCm39) missense probably benign 0.00
Z1088:Fat4 UTSW 3 38,941,199 (GRCm39) missense possibly damaging 0.88
Z1176:Fat4 UTSW 3 39,037,964 (GRCm39) missense probably damaging 1.00
Z1176:Fat4 UTSW 3 39,037,508 (GRCm39) missense probably benign 0.00
Z1177:Fat4 UTSW 3 38,944,496 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38,942,733 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 39,035,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGACTCGGGTGTCAATG -3'
(R):5'- GACTTCGTCTATGCTGAAGTGG -3'

Sequencing Primer
(F):5'- TGCTGACCTACACTACACTATTACAG -3'
(R):5'- CTATGCTGAAGTGGTTGCCTC -3'
Posted On 2014-09-17