Incidental Mutation 'R2056:Brap'
ID228179
Institutional Source Beutler Lab
Gene Symbol Brap
Ensembl Gene ENSMUSG00000029458
Gene NameBRCA1 associated protein
Synonyms3010002G07Rik
MMRRC Submission 040061-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2056 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121660563-121687256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121663466 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 95 (G95S)
Ref Sequence ENSEMBL: ENSMUSP00000143043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000031414] [ENSMUST00000111765] [ENSMUST00000111770] [ENSMUST00000140996] [ENSMUST00000142701] [ENSMUST00000195952]
Predicted Effect probably benign
Transcript: ENSMUST00000031412
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031414
AA Change: G139S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031414
Gene: ENSMUSG00000029458
AA Change: G139S

DomainStartEndE-ValueType
Pfam:BRAP2 153 251 3.7e-38 PFAM
RING 263 302 7.92e-8 SMART
ZnF_UBP 315 364 1.68e-25 SMART
coiled coil region 430 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111765
AA Change: G109S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107395
Gene: ENSMUSG00000029458
AA Change: G109S

DomainStartEndE-ValueType
Pfam:BRAP2 117 226 3.5e-41 PFAM
RING 233 272 3.7e-10 SMART
ZnF_UBP 285 334 1.1e-27 SMART
coiled coil region 400 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111770
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127703
SMART Domains Protein: ENSMUSP00000118574
Gene: ENSMUSG00000029458

DomainStartEndE-ValueType
Pfam:BRAP2 1 39 6.3e-13 PFAM
RING 46 85 7.92e-8 SMART
ZnF_UBP 98 147 1.68e-25 SMART
coiled coil region 213 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Predicted Effect probably benign
Transcript: ENSMUST00000140996
Predicted Effect probably damaging
Transcript: ENSMUST00000142701
AA Change: G95S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143043
Gene: ENSMUSG00000029458
AA Change: G95S

DomainStartEndE-ValueType
Pfam:BRAP2 103 175 3.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148052
Predicted Effect probably benign
Transcript: ENSMUST00000195952
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its ability to bind to the nuclear localization signal of BRCA1 and other proteins. It is a cytoplasmic protein which may regulate nuclear targeting by retaining proteins with a nuclear localization signal in the cytoplasm. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis and subtle defects in cell cycle-dependent nuclear movement in neural progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,573,745 R575G possibly damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adh1 A G 3: 138,286,915 D264G probably damaging Het
Ahnak2 T A 12: 112,785,006 D407V probably benign Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ankmy1 T C 1: 92,881,831 I662V possibly damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apc A G 18: 34,316,428 R2092G probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Cbfa2t2 G A 2: 154,535,157 A587T probably damaging Het
Ccdc180 A G 4: 45,932,477 I1308V probably benign Het
Ccser1 T A 6: 61,422,952 probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Cntln G A 4: 85,049,674 R710K probably benign Het
Csn1s1 A T 5: 87,671,528 T15S possibly damaging Het
Cul9 T C 17: 46,543,372 T135A probably benign Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dhx38 G T 8: 109,562,720 probably benign Het
Dis3 A T 14: 99,098,815 I85N possibly damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dscaml1 A G 9: 45,750,132 D1776G probably damaging Het
Erbin A G 13: 103,830,316 S1209P probably benign Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Fbxo45 G T 16: 32,238,528 Q183K possibly damaging Het
Frmd4b C T 6: 97,412,487 probably null Het
Fzd7 A G 1: 59,484,202 S415G probably benign Het
Gpd2 T A 2: 57,339,013 probably null Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gstcd T C 3: 133,082,053 I295V probably benign Het
Gucy1a1 A G 3: 82,109,285 L132P possibly damaging Het
Il12b A C 11: 44,407,900 T61P probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Itih3 A C 14: 30,909,524 probably null Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Kif11 A G 19: 37,402,212 N408D probably benign Het
Kng2 TATGACCATGACCATGACCATGACCATGACCATGACCAT TATGACCATGACCATGACCATGACCATGACCAT 16: 22,987,953 probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Krt9 G T 11: 100,191,495 N201K probably damaging Het
Lmbr1 G A 5: 29,233,094 P304L probably benign Het
Lrrfip1 A G 1: 91,115,817 N648S probably benign Het
Mab21l3 C A 3: 101,815,153 V386L possibly damaging Het
Mamdc4 T C 2: 25,564,168 Q1149R probably benign Het
Mast1 A G 8: 84,920,366 F677L possibly damaging Het
Mcoln3 A G 3: 146,128,224 D173G probably benign Het
Mmrn1 C T 6: 60,944,805 T82I probably benign Het
Muc5ac A G 7: 141,792,035 T203A probably benign Het
Myo9b T C 8: 71,359,690 I2035T possibly damaging Het
Ndst3 T C 3: 123,671,885 N146S probably damaging Het
Neu4 A G 1: 94,022,450 T21A possibly damaging Het
Nos1ap G A 1: 170,327,646 L267F probably damaging Het
Olfr1208 A G 2: 88,896,761 F279L probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr399 A T 11: 74,053,993 Y255* probably null Het
Phc1 T C 6: 122,333,340 N136S probably damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Psd2 A G 18: 36,006,691 D596G possibly damaging Het
Psmc3 T C 2: 91,058,088 F315L probably benign Het
Rerg G A 6: 137,057,880 T42I probably benign Het
Rif1 T A 2: 52,093,576 M577K probably damaging Het
Sap30 T C 8: 57,487,248 probably null Het
Scn2b T C 9: 45,125,517 Y108H probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb2 T C 1: 107,523,813 V232A probably damaging Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Slc27a4 T C 2: 29,810,941 W320R probably damaging Het
Soga1 C T 2: 157,022,827 G1154S probably benign Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thbs4 T A 13: 92,790,879 D34V probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem56 T G 3: 121,207,421 I188L probably benign Het
Tmod2 T C 9: 75,577,242 E248G probably benign Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ttn T C 2: 76,785,538 D8360G possibly damaging Het
Unc80 A G 1: 66,640,552 E2094G possibly damaging Het
Vmn2r18 A T 5: 151,584,695 D321E probably damaging Het
Other mutations in Brap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Brap APN 5 121665227 missense probably damaging 1.00
IGL01672:Brap APN 5 121678845 unclassified probably benign
IGL01889:Brap APN 5 121660818 missense probably benign 0.00
IGL01977:Brap APN 5 121678847 unclassified probably benign
IGL01978:Brap APN 5 121678847 unclassified probably benign
IGL01996:Brap APN 5 121678847 unclassified probably benign
IGL02499:Brap APN 5 121679871 missense probably damaging 0.99
IGL03137:Brap APN 5 121665093 splice site probably benign
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1624:Brap UTSW 5 121682859 missense possibly damaging 0.65
R1709:Brap UTSW 5 121665290 critical splice donor site probably null
R2109:Brap UTSW 5 121663359 missense possibly damaging 0.63
R3196:Brap UTSW 5 121665196 missense possibly damaging 0.70
R4591:Brap UTSW 5 121662050 missense probably null 1.00
R4744:Brap UTSW 5 121662130 missense probably damaging 1.00
R4924:Brap UTSW 5 121665255 missense probably damaging 1.00
R5000:Brap UTSW 5 121662026 nonsense probably null
R5702:Brap UTSW 5 121665143 missense probably damaging 1.00
R5893:Brap UTSW 5 121679342 nonsense probably null
R6244:Brap UTSW 5 121665309 missense probably benign 0.02
R6266:Brap UTSW 5 121685265 missense probably benign 0.00
R6726:Brap UTSW 5 121675302 missense probably damaging 1.00
R7765:Brap UTSW 5 121662129 missense probably damaging 1.00
R7995:Brap UTSW 5 121682846 missense probably benign
R8385:Brap UTSW 5 121685134 missense probably benign 0.05
X0003:Brap UTSW 5 121679256 missense probably damaging 1.00
Z1176:Brap UTSW 5 121675377 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TCCAGCTGTTTGTGATCTGC -3'
(R):5'- TTGGCCCAATCTACACTGTC -3'

Sequencing Primer
(F):5'- GCTGTTTGTGATCTGCTAATTTTCAC -3'
(R):5'- GGCCCAATCTACACTGTCAAACG -3'
Posted On2014-09-17