Mutagenetix > Incidental Mutation

Incidental Mutation 'R2056:Mmrn1'

228184

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

MMRRC Submission

040061-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2056 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 60944805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 82 (T82I)

Ref Sequence

ENSEMBL: ENSMUSP00000145156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000129603
AA Change: T82I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: T82I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145763

Predicted Effect

probably benign
Transcript: ENSMUST00000204333
AA Change: T82I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: T82I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	T	C	6: 50,573,745	R575G	possibly damaging	Het
Abcg2	T	C	6: 58,690,540	V129A	probably benign	Het
Adh1	A	G	3: 138,286,915	D264G	probably damaging	Het
Ahnak2	T	A	12: 112,785,006	D407V	probably benign	Het
Alas1	T	C	9: 106,241,290	E211G	probably damaging	Het
Alkbh1	C	T	12: 87,443,750		probably benign	Het
Ankmy1	T	C	1: 92,881,831	I662V	possibly damaging	Het
Ano1	A	G	7: 144,648,052	V334A	probably damaging	Het
Apc	A	G	18: 34,316,428	R2092G	probably damaging	Het
Arhgap18	C	T	10: 26,854,908	T122I	probably benign	Het
Atp2b4	G	T	1: 133,726,537	Q777K	probably benign	Het
Brap	G	A	5: 121,663,466	G95S	probably damaging	Het
Cbfa2t2	G	A	2: 154,535,157	A587T	probably damaging	Het
Ccdc180	A	G	4: 45,932,477	I1308V	probably benign	Het
Ccser1	T	A	6: 61,422,952		probably null	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cmtm4	A	C	8: 104,355,288	F156V	probably damaging	Het
Cntln	G	A	4: 85,049,674	R710K	probably benign	Het
Csn1s1	A	T	5: 87,671,528	T15S	possibly damaging	Het
Cul9	T	C	17: 46,543,372	T135A	probably benign	Het
Cyp2d10	T	A	15: 82,403,814	I363F	probably damaging	Het
Dhx38	G	T	8: 109,562,720		probably benign	Het
Dis3	A	T	14: 99,098,815	I85N	possibly damaging	Het
Dmbt1	G	A	7: 131,106,170	A1381T	possibly damaging	Het
Dscaml1	A	G	9: 45,750,132	D1776G	probably damaging	Het
Erbin	A	G	13: 103,830,316	S1209P	probably benign	Het
Fat4	T	A	3: 38,891,170	M1404K	possibly damaging	Het
Fbxo45	G	T	16: 32,238,528	Q183K	possibly damaging	Het
Frmd4b	C	T	6: 97,412,487		probably null	Het
Fzd7	A	G	1: 59,484,202	S415G	probably benign	Het
Gpd2	T	A	2: 57,339,013		probably null	Het
Gsk3b	T	A	16: 38,187,909	D192E	probably benign	Het
Gstcd	T	C	3: 133,082,053	I295V	probably benign	Het
Gucy1a1	A	G	3: 82,109,285	L132P	possibly damaging	Het
Il12b	A	C	11: 44,407,900	T61P	probably damaging	Het
Il7	A	T	3: 7,573,915	N130K	probably damaging	Het
Itih3	A	C	14: 30,909,524		probably null	Het
Kdm5b	T	A	1: 134,613,214	D681E	probably benign	Het
Kif11	A	G	19: 37,402,212	N408D	probably benign	Het
Kng2	TATGACCATGACCATGACCATGACCATGACCATGACCAT	TATGACCATGACCATGACCATGACCATGACCAT	16: 22,987,953		probably benign	Het
Kremen2	T	C	17: 23,742,717	E272G	possibly damaging	Het
Krt9	G	T	11: 100,191,495	N201K	probably damaging	Het
Lmbr1	G	A	5: 29,233,094	P304L	probably benign	Het
Lrrfip1	A	G	1: 91,115,817	N648S	probably benign	Het
Mab21l3	C	A	3: 101,815,153	V386L	possibly damaging	Het
Mamdc4	T	C	2: 25,564,168	Q1149R	probably benign	Het
Mast1	A	G	8: 84,920,366	F677L	possibly damaging	Het
Mcoln3	A	G	3: 146,128,224	D173G	probably benign	Het
Muc5ac	A	G	7: 141,792,035	T203A	probably benign	Het
Myo9b	T	C	8: 71,359,690	I2035T	possibly damaging	Het
Ndst3	T	C	3: 123,671,885	N146S	probably damaging	Het
Neu4	A	G	1: 94,022,450	T21A	possibly damaging	Het
Nos1ap	G	A	1: 170,327,646	L267F	probably damaging	Het
Olfr1208	A	G	2: 88,896,761	F279L	probably damaging	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Olfr399	A	T	11: 74,053,993	Y255*	probably null	Het
Phc1	T	C	6: 122,333,340	N136S	probably damaging	Het
Prkdc	A	G	16: 15,727,605	T1862A	probably benign	Het
Psd2	A	G	18: 36,006,691	D596G	possibly damaging	Het
Psmc3	T	C	2: 91,058,088	F315L	probably benign	Het
Rerg	G	A	6: 137,057,880	T42I	probably benign	Het
Rif1	T	A	2: 52,093,576	M577K	probably damaging	Het
Sap30	T	C	8: 57,487,248		probably null	Het
Scn2b	T	C	9: 45,125,517	Y108H	probably damaging	Het
Senp2	C	T	16: 22,014,199	T79I	probably damaging	Het
Serpinb2	T	C	1: 107,523,813	V232A	probably damaging	Het
Sgpp2	T	A	1: 78,416,951	L197Q	probably damaging	Het
Slc27a4	T	C	2: 29,810,941	W320R	probably damaging	Het
Soga1	C	T	2: 157,022,827	G1154S	probably benign	Het
Tgm4	T	C	9: 123,061,770	I54T	probably damaging	Het
Thbs4	T	A	13: 92,790,879	D34V	probably benign	Het
Tmem176b	G	A	6: 48,836,333	T64I	probably damaging	Het
Tmem56	T	G	3: 121,207,421	I188L	probably benign	Het
Tmod2	T	C	9: 75,577,242	E248G	probably benign	Het
Ttc6	T	A	12: 57,737,693	D1849E	probably benign	Het
Ttn	T	C	2: 76,785,538	D8360G	possibly damaging	Het
Unc80	A	G	1: 66,640,552	E2094G	possibly damaging	Het
Vmn2r18	A	T	5: 151,584,695	D321E	probably damaging	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TCAACATTCATGGACTGCGC -3'
(R):5'- AGCCGACTTAGTGGAGACTTC -3'

Sequencing Primer
(F):5'- ATTCATGGACTGCGCCTAAG -3'
(R):5'- CAGACTTTCTGGAAAAACTCTGAAGG -3'

Posted On

2014-09-17