Incidental Mutation 'R2056:Frmd4b'
ID228186
Institutional Source Beutler Lab
Gene Symbol Frmd4b
Ensembl Gene ENSMUSG00000030064
Gene NameFERM domain containing 4B
Synonyms6030440G05Rik, GRSP1
MMRRC Submission 040061-MU
Accession Numbers

Ncbi RefSeq: NM_145148.2; MGI:2141794

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2056 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location97286867-97617541 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 97412487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032146] [ENSMUST00000032146] [ENSMUST00000032146] [ENSMUST00000113355] [ENSMUST00000113355] [ENSMUST00000113355] [ENSMUST00000113359] [ENSMUST00000113359] [ENSMUST00000113359] [ENSMUST00000124050] [ENSMUST00000124050] [ENSMUST00000124050] [ENSMUST00000124050] [ENSMUST00000124050] [ENSMUST00000124050]
Predicted Effect probably null
Transcript: ENSMUST00000032146
SMART Domains Protein: ENSMUSP00000032146
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 55 260 7.4e-35 SMART
FERM_C 264 365 8.7e-26 SMART
Pfam:DUF3338 395 529 4.5e-55 PFAM
coiled coil region 534 558 N/A INTRINSIC
low complexity region 571 592 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 941 958 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000032146
SMART Domains Protein: ENSMUSP00000032146
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 55 260 7.4e-35 SMART
FERM_C 264 365 8.7e-26 SMART
Pfam:DUF3338 395 529 4.5e-55 PFAM
coiled coil region 534 558 N/A INTRINSIC
low complexity region 571 592 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 941 958 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000032146
SMART Domains Protein: ENSMUSP00000032146
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 55 260 7.4e-35 SMART
FERM_C 264 365 8.7e-26 SMART
Pfam:DUF3338 395 529 4.5e-55 PFAM
coiled coil region 534 558 N/A INTRINSIC
low complexity region 571 592 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 941 958 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113353
SMART Domains Protein: ENSMUSP00000108980
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 55 260 7.4e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113355
SMART Domains Protein: ENSMUSP00000108982
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 1 206 4.5e-37 SMART
FERM_C 210 311 4.1e-30 SMART
Pfam:DUF3338 340 476 6.9e-58 PFAM
coiled coil region 480 504 N/A INTRINSIC
low complexity region 517 538 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
low complexity region 887 904 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113355
SMART Domains Protein: ENSMUSP00000108982
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 1 206 4.5e-37 SMART
FERM_C 210 311 4.1e-30 SMART
Pfam:DUF3338 340 476 6.9e-58 PFAM
coiled coil region 480 504 N/A INTRINSIC
low complexity region 517 538 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
low complexity region 887 904 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113355
SMART Domains Protein: ENSMUSP00000108982
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 1 206 4.5e-37 SMART
FERM_C 210 311 4.1e-30 SMART
Pfam:DUF3338 340 476 6.9e-58 PFAM
coiled coil region 480 504 N/A INTRINSIC
low complexity region 517 538 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
low complexity region 887 904 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113359
SMART Domains Protein: ENSMUSP00000108986
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 9 214 7.4e-35 SMART
FERM_C 218 319 8.7e-26 SMART
Pfam:DUF3338 348 484 8e-61 PFAM
coiled coil region 488 512 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
low complexity region 895 912 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113359
SMART Domains Protein: ENSMUSP00000108986
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 9 214 7.4e-35 SMART
FERM_C 218 319 8.7e-26 SMART
Pfam:DUF3338 348 484 8e-61 PFAM
coiled coil region 488 512 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
low complexity region 895 912 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113359
SMART Domains Protein: ENSMUSP00000108986
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 9 214 7.4e-35 SMART
FERM_C 218 319 8.7e-26 SMART
Pfam:DUF3338 348 484 8e-61 PFAM
coiled coil region 488 512 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
low complexity region 895 912 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124050
SMART Domains Protein: ENSMUSP00000145240
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
Pfam:FERM_N 9 71 3.2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124050
SMART Domains Protein: ENSMUSP00000145240
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
Pfam:FERM_N 9 71 3.2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124050
SMART Domains Protein: ENSMUSP00000145240
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
Pfam:FERM_N 9 71 3.2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124050
SMART Domains Protein: ENSMUSP00000145240
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
Pfam:FERM_N 9 71 3.2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124050
SMART Domains Protein: ENSMUSP00000145240
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
Pfam:FERM_N 9 71 3.2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124050
SMART Domains Protein: ENSMUSP00000145240
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
Pfam:FERM_N 9 71 3.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142589
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GRP1-binding protein which contains a FERM protein interaction domain as well as two coiled coil domains. This protein may play a role as a scaffolding protein. [provided by RefSeq, Mar 2014]
Allele List at MGI

All alleles(24) : Targeted(2) Gene trapped(22)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,573,745 R575G possibly damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adh1 A G 3: 138,286,915 D264G probably damaging Het
Ahnak2 T A 12: 112,785,006 D407V probably benign Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ankmy1 T C 1: 92,881,831 I662V possibly damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apc A G 18: 34,316,428 R2092G probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Brap G A 5: 121,663,466 G95S probably damaging Het
Cbfa2t2 G A 2: 154,535,157 A587T probably damaging Het
Ccdc180 A G 4: 45,932,477 I1308V probably benign Het
Ccser1 T A 6: 61,422,952 probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Cntln G A 4: 85,049,674 R710K probably benign Het
Csn1s1 A T 5: 87,671,528 T15S possibly damaging Het
Cul9 T C 17: 46,543,372 T135A probably benign Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dhx38 G T 8: 109,562,720 probably benign Het
Dis3 A T 14: 99,098,815 I85N possibly damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dscaml1 A G 9: 45,750,132 D1776G probably damaging Het
Erbin A G 13: 103,830,316 S1209P probably benign Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Fbxo45 G T 16: 32,238,528 Q183K possibly damaging Het
Fzd7 A G 1: 59,484,202 S415G probably benign Het
Gpd2 T A 2: 57,339,013 probably null Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gstcd T C 3: 133,082,053 I295V probably benign Het
Gucy1a1 A G 3: 82,109,285 L132P possibly damaging Het
Il12b A C 11: 44,407,900 T61P probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Itih3 A C 14: 30,909,524 probably null Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Kif11 A G 19: 37,402,212 N408D probably benign Het
Kng2 TATGACCATGACCATGACCATGACCATGACCATGACCAT TATGACCATGACCATGACCATGACCATGACCAT 16: 22,987,953 probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Krt9 G T 11: 100,191,495 N201K probably damaging Het
Lmbr1 G A 5: 29,233,094 P304L probably benign Het
Lrrfip1 A G 1: 91,115,817 N648S probably benign Het
Mab21l3 C A 3: 101,815,153 V386L possibly damaging Het
Mamdc4 T C 2: 25,564,168 Q1149R probably benign Het
Mast1 A G 8: 84,920,366 F677L possibly damaging Het
Mcoln3 A G 3: 146,128,224 D173G probably benign Het
Mmrn1 C T 6: 60,944,805 T82I probably benign Het
Muc5ac A G 7: 141,792,035 T203A probably benign Het
Myo9b T C 8: 71,359,690 I2035T possibly damaging Het
Ndst3 T C 3: 123,671,885 N146S probably damaging Het
Neu4 A G 1: 94,022,450 T21A possibly damaging Het
Nos1ap G A 1: 170,327,646 L267F probably damaging Het
Olfr1208 A G 2: 88,896,761 F279L probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr399 A T 11: 74,053,993 Y255* probably null Het
Phc1 T C 6: 122,333,340 N136S probably damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Psd2 A G 18: 36,006,691 D596G possibly damaging Het
Psmc3 T C 2: 91,058,088 F315L probably benign Het
Rerg G A 6: 137,057,880 T42I probably benign Het
Rif1 T A 2: 52,093,576 M577K probably damaging Het
Sap30 T C 8: 57,487,248 probably null Het
Scn2b T C 9: 45,125,517 Y108H probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb2 T C 1: 107,523,813 V232A probably damaging Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Slc27a4 T C 2: 29,810,941 W320R probably damaging Het
Soga1 C T 2: 157,022,827 G1154S probably benign Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thbs4 T A 13: 92,790,879 D34V probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem56 T G 3: 121,207,421 I188L probably benign Het
Tmod2 T C 9: 75,577,242 E248G probably benign Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ttn T C 2: 76,785,538 D8360G possibly damaging Het
Unc80 A G 1: 66,640,552 E2094G possibly damaging Het
Vmn2r18 A T 5: 151,584,695 D321E probably damaging Het
Other mutations in Frmd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Frmd4b APN 6 97308060 missense probably damaging 1.00
IGL01478:Frmd4b APN 6 97328293 missense probably damaging 1.00
IGL01760:Frmd4b APN 6 97308702 missense probably damaging 1.00
IGL01777:Frmd4b APN 6 97295944 missense probably benign 0.03
IGL01960:Frmd4b APN 6 97295780 missense possibly damaging 0.93
IGL02408:Frmd4b APN 6 97295809 missense probably damaging 1.00
IGL02429:Frmd4b APN 6 97325429 splice site probably benign
IGL02525:Frmd4b APN 6 97412533 missense probably damaging 1.00
IGL02618:Frmd4b APN 6 97308105 nonsense probably null
IGL03051:Frmd4b APN 6 97295982 nonsense probably null
IGL03120:Frmd4b APN 6 97396245 missense possibly damaging 0.88
IGL03218:Frmd4b APN 6 97308114 missense probably benign 0.01
IGL03260:Frmd4b APN 6 97396224 missense probably damaging 1.00
IGL02984:Frmd4b UTSW 6 97296260 missense probably damaging 0.96
P0031:Frmd4b UTSW 6 97354030 missense probably damaging 1.00
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0058:Frmd4b UTSW 6 97423499 missense probably damaging 1.00
R0255:Frmd4b UTSW 6 97308086 missense probably damaging 1.00
R0437:Frmd4b UTSW 6 97423463 missense probably damaging 1.00
R0594:Frmd4b UTSW 6 97325426 splice site probably benign
R1525:Frmd4b UTSW 6 97296386 missense probably damaging 0.97
R1640:Frmd4b UTSW 6 97308673 missense possibly damaging 0.91
R1768:Frmd4b UTSW 6 97306764 missense possibly damaging 0.68
R1923:Frmd4b UTSW 6 97288454 missense probably benign 0.33
R2192:Frmd4b UTSW 6 97487616 missense probably damaging 0.98
R3809:Frmd4b UTSW 6 97323729 missense possibly damaging 0.49
R3831:Frmd4b UTSW 6 97412525 nonsense probably null
R4466:Frmd4b UTSW 6 97323653 critical splice donor site probably null
R4536:Frmd4b UTSW 6 97310732 missense possibly damaging 0.57
R4652:Frmd4b UTSW 6 97295755 missense probably benign 0.38
R4679:Frmd4b UTSW 6 97295666 missense possibly damaging 0.94
R4735:Frmd4b UTSW 6 97459259 start gained probably benign
R4793:Frmd4b UTSW 6 97295861 missense probably damaging 0.99
R4940:Frmd4b UTSW 6 97298090 missense probably damaging 1.00
R4948:Frmd4b UTSW 6 97306730 missense probably benign 0.06
R5092:Frmd4b UTSW 6 97295980 missense probably damaging 0.98
R5119:Frmd4b UTSW 6 97300314 missense probably benign 0.03
R5289:Frmd4b UTSW 6 97302348 splice site probably null
R5610:Frmd4b UTSW 6 97306791 missense probably benign
R5690:Frmd4b UTSW 6 97353203 missense possibly damaging 0.56
R6248:Frmd4b UTSW 6 97459212 missense probably benign 0.10
R6437:Frmd4b UTSW 6 97296267 missense probably damaging 1.00
R6459:Frmd4b UTSW 6 97487640 missense probably damaging 1.00
R6825:Frmd4b UTSW 6 97325476 missense possibly damaging 0.89
R6964:Frmd4b UTSW 6 97305197 missense probably damaging 1.00
R7110:Frmd4b UTSW 6 97296231 nonsense probably null
R7154:Frmd4b UTSW 6 97306746 missense probably damaging 1.00
R7764:Frmd4b UTSW 6 97295930 missense probably damaging 1.00
R8073:Frmd4b UTSW 6 97306713 missense probably benign 0.03
R8382:Frmd4b UTSW 6 97305248 missense probably benign
X0020:Frmd4b UTSW 6 97305365 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCTTTGAGGAATAAAGCTGGATGC -3'
(R):5'- TGAGTGTTTCCAGGCAGCTG -3'

Sequencing Primer
(F):5'- GATGCTTCTCTCCTTTATCTTCAAAG -3'
(R):5'- GTGCCAGCACCGTGTGTTG -3'
Posted On2014-09-17