Incidental Mutation 'R2056:Alkbh1'
ID228209
Institutional Source Beutler Lab
Gene Symbol Alkbh1
Ensembl Gene ENSMUSG00000079036
Gene NamealkB homolog 1, histone H2A dioxygenase
SynonymsalkB, Nrp, Alkbh
MMRRC Submission 040061-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R2056 (G1)
Quality Score211
Status Not validated
Chromosome12
Chromosomal Location87425840-87444017 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 87443750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077462] [ENSMUST00000159079] [ENSMUST00000160113] [ENSMUST00000160488] [ENSMUST00000161023] [ENSMUST00000161712] [ENSMUST00000162247] [ENSMUST00000162961] [ENSMUST00000185301] [ENSMUST00000162986]
Predicted Effect probably benign
Transcript: ENSMUST00000077462
SMART Domains Protein: ENSMUSP00000076673
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 18 82 1.08e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091090
SMART Domains Protein: ENSMUSP00000088619
Gene: ENSMUSG00000021041

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000159079
SMART Domains Protein: ENSMUSP00000124445
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000160113
SMART Domains Protein: ENSMUSP00000124691
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160488
SMART Domains Protein: ENSMUSP00000124174
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 20 92 2.41e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160850
Predicted Effect probably benign
Transcript: ENSMUST00000160880
SMART Domains Protein: ENSMUSP00000125727
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
Blast:RRM 15 47 6e-17 BLAST
SCOP:d1u2fa_ 17 59 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160919
Predicted Effect probably benign
Transcript: ENSMUST00000161023
SMART Domains Protein: ENSMUSP00000125341
Gene: ENSMUSG00000021040

DomainStartEndE-ValueType
RRM 20 92 1.73e-18 SMART
Predicted Effect silent
Transcript: ENSMUST00000161712
SMART Domains Protein: ENSMUSP00000124933
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000162247
SMART Domains Protein: ENSMUSP00000124360
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000162961
SMART Domains Protein: ENSMUSP00000124565
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 98 344 6.7e-38 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000185301
AA Change: A57T
SMART Domains Protein: ENSMUSP00000140233
Gene: ENSMUSG00000079036
AA Change: A57T

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000162986
SMART Domains Protein: ENSMUSP00000125372
Gene: ENSMUSG00000079036

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog to the E. coli alkB gene product. The E. coli alkB protein is part of the adaptive response mechanism of DNA alkylation damage repair. It is involved in damage reversal by oxidative demethylation of 1-methyladenine and 3-methylcytosine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show delayed fetal growth, impaired placental development and low birth weight. Mice homozygous for another null allele show sex-ratio distortion, reduced survival, spermatogenic defects and incompletely penetrant eye, neural tube, skeleton and craniofacial defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,573,745 R575G possibly damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adh1 A G 3: 138,286,915 D264G probably damaging Het
Ahnak2 T A 12: 112,785,006 D407V probably benign Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Ankmy1 T C 1: 92,881,831 I662V possibly damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apc A G 18: 34,316,428 R2092G probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Brap G A 5: 121,663,466 G95S probably damaging Het
Cbfa2t2 G A 2: 154,535,157 A587T probably damaging Het
Ccdc180 A G 4: 45,932,477 I1308V probably benign Het
Ccser1 T A 6: 61,422,952 probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Cntln G A 4: 85,049,674 R710K probably benign Het
Csn1s1 A T 5: 87,671,528 T15S possibly damaging Het
Cul9 T C 17: 46,543,372 T135A probably benign Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dhx38 G T 8: 109,562,720 probably benign Het
Dis3 A T 14: 99,098,815 I85N possibly damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dscaml1 A G 9: 45,750,132 D1776G probably damaging Het
Erbin A G 13: 103,830,316 S1209P probably benign Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Fbxo45 G T 16: 32,238,528 Q183K possibly damaging Het
Frmd4b C T 6: 97,412,487 probably null Het
Fzd7 A G 1: 59,484,202 S415G probably benign Het
Gpd2 T A 2: 57,339,013 probably null Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gstcd T C 3: 133,082,053 I295V probably benign Het
Gucy1a1 A G 3: 82,109,285 L132P possibly damaging Het
Il12b A C 11: 44,407,900 T61P probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Itih3 A C 14: 30,909,524 probably null Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Kif11 A G 19: 37,402,212 N408D probably benign Het
Kng2 TATGACCATGACCATGACCATGACCATGACCATGACCAT TATGACCATGACCATGACCATGACCATGACCAT 16: 22,987,953 probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Krt9 G T 11: 100,191,495 N201K probably damaging Het
Lmbr1 G A 5: 29,233,094 P304L probably benign Het
Lrrfip1 A G 1: 91,115,817 N648S probably benign Het
Mab21l3 C A 3: 101,815,153 V386L possibly damaging Het
Mamdc4 T C 2: 25,564,168 Q1149R probably benign Het
Mast1 A G 8: 84,920,366 F677L possibly damaging Het
Mcoln3 A G 3: 146,128,224 D173G probably benign Het
Mmrn1 C T 6: 60,944,805 T82I probably benign Het
Muc5ac A G 7: 141,792,035 T203A probably benign Het
Myo9b T C 8: 71,359,690 I2035T possibly damaging Het
Ndst3 T C 3: 123,671,885 N146S probably damaging Het
Neu4 A G 1: 94,022,450 T21A possibly damaging Het
Nos1ap G A 1: 170,327,646 L267F probably damaging Het
Olfr1208 A G 2: 88,896,761 F279L probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr399 A T 11: 74,053,993 Y255* probably null Het
Phc1 T C 6: 122,333,340 N136S probably damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Psd2 A G 18: 36,006,691 D596G possibly damaging Het
Psmc3 T C 2: 91,058,088 F315L probably benign Het
Rerg G A 6: 137,057,880 T42I probably benign Het
Rif1 T A 2: 52,093,576 M577K probably damaging Het
Sap30 T C 8: 57,487,248 probably null Het
Scn2b T C 9: 45,125,517 Y108H probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb2 T C 1: 107,523,813 V232A probably damaging Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Slc27a4 T C 2: 29,810,941 W320R probably damaging Het
Soga1 C T 2: 157,022,827 G1154S probably benign Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thbs4 T A 13: 92,790,879 D34V probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem56 T G 3: 121,207,421 I188L probably benign Het
Tmod2 T C 9: 75,577,242 E248G probably benign Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ttn T C 2: 76,785,538 D8360G possibly damaging Het
Unc80 A G 1: 66,640,552 E2094G possibly damaging Het
Vmn2r18 A T 5: 151,584,695 D321E probably damaging Het
Other mutations in Alkbh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Alkbh1 APN 12 87443697 missense probably damaging 1.00
IGL03111:Alkbh1 APN 12 87434137 missense probably damaging 1.00
IGL03264:Alkbh1 APN 12 87431427 missense probably damaging 1.00
R1439:Alkbh1 UTSW 12 87429145 missense probably damaging 1.00
R2058:Alkbh1 UTSW 12 87443750 unclassified probably benign
R2059:Alkbh1 UTSW 12 87443750 unclassified probably benign
R4565:Alkbh1 UTSW 12 87431466 missense probably damaging 1.00
R5712:Alkbh1 UTSW 12 87429113 missense probably benign 0.05
R6291:Alkbh1 UTSW 12 87429094 missense possibly damaging 0.67
R7593:Alkbh1 UTSW 12 87440325 nonsense probably null
R7776:Alkbh1 UTSW 12 87431445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCGCTCGACATTACAGCTC -3'
(R):5'- TGAATCGAAACCCTGGAGTC -3'

Sequencing Primer
(F):5'- GGGCTTCCCTCCAAAGC -3'
(R):5'- ATCGAAACCCTGGAGTCGTGAC -3'
Posted On2014-09-17