Incidental Mutation 'R2056:Cyp2d10'
ID228216
Institutional Source Beutler Lab
Gene Symbol Cyp2d10
Ensembl Gene ENSMUSG00000094806
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 10
SynonymsCyp2d, P450-2D
MMRRC Submission 040061-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R2056 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82402846-82407195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82403814 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 363 (I363F)
Ref Sequence ENSEMBL: ENSMUSP00000155626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072776] [ENSMUST00000229628] [ENSMUST00000229911] [ENSMUST00000230198] [ENSMUST00000230248] [ENSMUST00000230843]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072776
AA Change: I363F

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072555
Gene: ENSMUSG00000094806
AA Change: I363F

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Pfam:p450 37 497 6e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183705
Predicted Effect probably benign
Transcript: ENSMUST00000229628
Predicted Effect probably benign
Transcript: ENSMUST00000229911
Predicted Effect probably damaging
Transcript: ENSMUST00000230198
AA Change: I363F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000230248
Predicted Effect probably benign
Transcript: ENSMUST00000230843
AA Change: I204F

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.2767 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,573,745 R575G possibly damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adh1 A G 3: 138,286,915 D264G probably damaging Het
Ahnak2 T A 12: 112,785,006 D407V probably benign Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ankmy1 T C 1: 92,881,831 I662V possibly damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apc A G 18: 34,316,428 R2092G probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
Brap G A 5: 121,663,466 G95S probably damaging Het
Cbfa2t2 G A 2: 154,535,157 A587T probably damaging Het
Ccdc180 A G 4: 45,932,477 I1308V probably benign Het
Ccser1 T A 6: 61,422,952 probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Cntln G A 4: 85,049,674 R710K probably benign Het
Csn1s1 A T 5: 87,671,528 T15S possibly damaging Het
Cul9 T C 17: 46,543,372 T135A probably benign Het
Dhx38 G T 8: 109,562,720 probably benign Het
Dis3 A T 14: 99,098,815 I85N possibly damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dscaml1 A G 9: 45,750,132 D1776G probably damaging Het
Erbin A G 13: 103,830,316 S1209P probably benign Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Fbxo45 G T 16: 32,238,528 Q183K possibly damaging Het
Frmd4b C T 6: 97,412,487 probably null Het
Fzd7 A G 1: 59,484,202 S415G probably benign Het
Gpd2 T A 2: 57,339,013 probably null Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gstcd T C 3: 133,082,053 I295V probably benign Het
Gucy1a1 A G 3: 82,109,285 L132P possibly damaging Het
Il12b A C 11: 44,407,900 T61P probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Itih3 A C 14: 30,909,524 probably null Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Kif11 A G 19: 37,402,212 N408D probably benign Het
Kng2 TATGACCATGACCATGACCATGACCATGACCATGACCAT TATGACCATGACCATGACCATGACCATGACCAT 16: 22,987,953 probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Krt9 G T 11: 100,191,495 N201K probably damaging Het
Lmbr1 G A 5: 29,233,094 P304L probably benign Het
Lrrfip1 A G 1: 91,115,817 N648S probably benign Het
Mab21l3 C A 3: 101,815,153 V386L possibly damaging Het
Mamdc4 T C 2: 25,564,168 Q1149R probably benign Het
Mast1 A G 8: 84,920,366 F677L possibly damaging Het
Mcoln3 A G 3: 146,128,224 D173G probably benign Het
Mmrn1 C T 6: 60,944,805 T82I probably benign Het
Muc5ac A G 7: 141,792,035 T203A probably benign Het
Myo9b T C 8: 71,359,690 I2035T possibly damaging Het
Ndst3 T C 3: 123,671,885 N146S probably damaging Het
Neu4 A G 1: 94,022,450 T21A possibly damaging Het
Nos1ap G A 1: 170,327,646 L267F probably damaging Het
Olfr1208 A G 2: 88,896,761 F279L probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr399 A T 11: 74,053,993 Y255* probably null Het
Phc1 T C 6: 122,333,340 N136S probably damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Psd2 A G 18: 36,006,691 D596G possibly damaging Het
Psmc3 T C 2: 91,058,088 F315L probably benign Het
Rerg G A 6: 137,057,880 T42I probably benign Het
Rif1 T A 2: 52,093,576 M577K probably damaging Het
Sap30 T C 8: 57,487,248 probably null Het
Scn2b T C 9: 45,125,517 Y108H probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb2 T C 1: 107,523,813 V232A probably damaging Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Slc27a4 T C 2: 29,810,941 W320R probably damaging Het
Soga1 C T 2: 157,022,827 G1154S probably benign Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thbs4 T A 13: 92,790,879 D34V probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem56 T G 3: 121,207,421 I188L probably benign Het
Tmod2 T C 9: 75,577,242 E248G probably benign Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ttn T C 2: 76,785,538 D8360G possibly damaging Het
Unc80 A G 1: 66,640,552 E2094G possibly damaging Het
Vmn2r18 A T 5: 151,584,695 D321E probably damaging Het
Other mutations in Cyp2d10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Cyp2d10 APN 15 82403314 missense possibly damaging 0.71
IGL00840:Cyp2d10 APN 15 82404490 missense probably benign 0.40
IGL01293:Cyp2d10 APN 15 82403009 missense possibly damaging 0.92
IGL01339:Cyp2d10 APN 15 82403841 missense probably benign 0.33
IGL01871:Cyp2d10 APN 15 82403885 missense probably damaging 1.00
IGL02132:Cyp2d10 APN 15 82404607 intron probably benign
IGL02713:Cyp2d10 APN 15 82406082 unclassified probably benign
IGL02869:Cyp2d10 APN 15 82403868 missense possibly damaging 0.84
R0102:Cyp2d10 UTSW 15 82404593 missense probably benign 0.01
R0102:Cyp2d10 UTSW 15 82404593 missense probably benign 0.01
R0279:Cyp2d10 UTSW 15 82405339 missense possibly damaging 0.94
R0331:Cyp2d10 UTSW 15 82407026 missense probably benign 0.12
R1344:Cyp2d10 UTSW 15 82405905 critical splice donor site probably null
R1418:Cyp2d10 UTSW 15 82405905 critical splice donor site probably null
R1465:Cyp2d10 UTSW 15 82403928 splice site probably null
R1465:Cyp2d10 UTSW 15 82403928 splice site probably null
R1706:Cyp2d10 UTSW 15 82405582 missense probably damaging 0.96
R1712:Cyp2d10 UTSW 15 82403039 missense probably damaging 1.00
R1940:Cyp2d10 UTSW 15 82405294 missense probably benign 0.13
R1983:Cyp2d10 UTSW 15 82405999 missense probably benign 0.15
R2058:Cyp2d10 UTSW 15 82403814 missense probably damaging 1.00
R3707:Cyp2d10 UTSW 15 82403016 missense possibly damaging 0.91
R3708:Cyp2d10 UTSW 15 82403016 missense possibly damaging 0.91
R4042:Cyp2d10 UTSW 15 82406068 missense probably benign 0.33
R4531:Cyp2d10 UTSW 15 82405261 missense probably benign 0.31
R4694:Cyp2d10 UTSW 15 82404483 missense probably damaging 1.00
R4869:Cyp2d10 UTSW 15 82403766 missense probably benign 0.00
R5071:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5072:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5073:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5074:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5746:Cyp2d10 UTSW 15 82405271 missense probably benign 0.38
R7096:Cyp2d10 UTSW 15 82405261 missense probably benign
R7212:Cyp2d10 UTSW 15 82404246 critical splice acceptor site probably null
R7324:Cyp2d10 UTSW 15 82403760 missense probably damaging 0.97
R7487:Cyp2d10 UTSW 15 82404592 missense probably benign 0.00
R7915:Cyp2d10 UTSW 15 82404427 critical splice donor site probably null
X0063:Cyp2d10 UTSW 15 82406000 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTAAAAGGCTGCACCCTG -3'
(R):5'- GATTCTTGTGGCACCCAGTG -3'

Sequencing Primer
(F):5'- GCACCCTGCATGCATTCTGG -3'
(R):5'- AGACTCCAGTGCCGCTC -3'
Posted On2014-09-17