Mutagenetix > Incidental Mutations

Incidental Mutation 'R2056:Cul9'

228224

Institutional Source

Beutler Lab

Gene Symbol

Cul9

Ensembl Gene

ENSMUSG00000040327

Gene Name

cullin 9

Synonyms

1810035I07Rik, Parc

MMRRC Submission

040061-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.230) question?

Stock #

R2056 (G1)

Quality Score

218

Status

Not validated

Chromosome

Chromosomal Location

46500572-46546388 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46543372 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 135 (T135A)

Ref Sequence

ENSEMBL: ENSMUSP00000138418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015749] [ENSMUST00000066026] [ENSMUST00000182485]

Predicted Effect

probably benign
Transcript: ENSMUST00000015749

SMART Domains

Protein: ENSMUSP00000015749
Gene: ENSMUSG00000015605

Domain	Start	End	E-Value	Type
low complexity region	6	46	N/A	INTRINSIC
low complexity region	60	70	N/A	INTRINSIC
low complexity region	73	90	N/A	INTRINSIC
low complexity region	104	130	N/A	INTRINSIC
MADS	137	196	3.08e-28	SMART
low complexity region	217	229	N/A	INTRINSIC
Blast:MADS	256	289	3e-11	BLAST
low complexity region	300	314	N/A	INTRINSIC
internal_repeat_1	335	360	6.39e-6	PROSPERO
low complexity region	368	383	N/A	INTRINSIC
internal_repeat_1	450	473	6.39e-6	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000066026
AA Change: T135A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: T135A

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	441	1e-35	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	2e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
low complexity region	2503	2520	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182315

Predicted Effect

probably benign
Transcript: ENSMUST00000182485
AA Change: T135A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: T135A

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	442	1.4e-33	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	3e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
coiled coil region	2461	2497	N/A	INTRINSIC
low complexity region	2513	2530	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	T	C	6: 50,573,745	R575G	possibly damaging	Het
Abcg2	T	C	6: 58,690,540	V129A	probably benign	Het
Adh1	A	G	3: 138,286,915	D264G	probably damaging	Het
Ahnak2	T	A	12: 112,785,006	D407V	probably benign	Het
Alas1	T	C	9: 106,241,290	E211G	probably damaging	Het
Alkbh1	C	T	12: 87,443,750		probably benign	Het
Ankmy1	T	C	1: 92,881,831	I662V	possibly damaging	Het
Ano1	A	G	7: 144,648,052	V334A	probably damaging	Het
Apc	A	G	18: 34,316,428	R2092G	probably damaging	Het
Arhgap18	C	T	10: 26,854,908	T122I	probably benign	Het
Atp2b4	G	T	1: 133,726,537	Q777K	probably benign	Het
Brap	G	A	5: 121,663,466	G95S	probably damaging	Het
Cbfa2t2	G	A	2: 154,535,157	A587T	probably damaging	Het
Ccdc180	A	G	4: 45,932,477	I1308V	probably benign	Het
Ccser1	T	A	6: 61,422,952		probably null	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cmtm4	A	C	8: 104,355,288	F156V	probably damaging	Het
Cntln	G	A	4: 85,049,674	R710K	probably benign	Het
Csn1s1	A	T	5: 87,671,528	T15S	possibly damaging	Het
Cyp2d10	T	A	15: 82,403,814	I363F	probably damaging	Het
Dhx38	G	T	8: 109,562,720		probably benign	Het
Dis3	A	T	14: 99,098,815	I85N	possibly damaging	Het
Dmbt1	G	A	7: 131,106,170	A1381T	possibly damaging	Het
Dscaml1	A	G	9: 45,750,132	D1776G	probably damaging	Het
Erbin	A	G	13: 103,830,316	S1209P	probably benign	Het
Fat4	T	A	3: 38,891,170	M1404K	possibly damaging	Het
Fbxo45	G	T	16: 32,238,528	Q183K	possibly damaging	Het
Frmd4b	C	T	6: 97,412,487		probably null	Het
Fzd7	A	G	1: 59,484,202	S415G	probably benign	Het
Gpd2	T	A	2: 57,339,013		probably null	Het
Gsk3b	T	A	16: 38,187,909	D192E	probably benign	Het
Gstcd	T	C	3: 133,082,053	I295V	probably benign	Het
Gucy1a1	A	G	3: 82,109,285	L132P	possibly damaging	Het
Il12b	A	C	11: 44,407,900	T61P	probably damaging	Het
Il7	A	T	3: 7,573,915	N130K	probably damaging	Het
Itih3	A	C	14: 30,909,524		probably null	Het
Kdm5b	T	A	1: 134,613,214	D681E	probably benign	Het
Kif11	A	G	19: 37,402,212	N408D	probably benign	Het
Kng2	TATGACCATGACCATGACCATGACCATGACCATGACCAT	TATGACCATGACCATGACCATGACCATGACCAT	16: 22,987,953		probably benign	Het
Kremen2	T	C	17: 23,742,717	E272G	possibly damaging	Het
Krt9	G	T	11: 100,191,495	N201K	probably damaging	Het
Lmbr1	G	A	5: 29,233,094	P304L	probably benign	Het
Lrrfip1	A	G	1: 91,115,817	N648S	probably benign	Het
Mab21l3	C	A	3: 101,815,153	V386L	possibly damaging	Het
Mamdc4	T	C	2: 25,564,168	Q1149R	probably benign	Het
Mast1	A	G	8: 84,920,366	F677L	possibly damaging	Het
Mcoln3	A	G	3: 146,128,224	D173G	probably benign	Het
Mmrn1	C	T	6: 60,944,805	T82I	probably benign	Het
Muc5ac	A	G	7: 141,792,035	T203A	probably benign	Het
Myo9b	T	C	8: 71,359,690	I2035T	possibly damaging	Het
Ndst3	T	C	3: 123,671,885	N146S	probably damaging	Het
Neu4	A	G	1: 94,022,450	T21A	possibly damaging	Het
Nos1ap	G	A	1: 170,327,646	L267F	probably damaging	Het
Olfr1208	A	G	2: 88,896,761	F279L	probably damaging	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Olfr399	A	T	11: 74,053,993	Y255*	probably null	Het
Phc1	T	C	6: 122,333,340	N136S	probably damaging	Het
Prkdc	A	G	16: 15,727,605	T1862A	probably benign	Het
Psd2	A	G	18: 36,006,691	D596G	possibly damaging	Het
Psmc3	T	C	2: 91,058,088	F315L	probably benign	Het
Rerg	G	A	6: 137,057,880	T42I	probably benign	Het
Rif1	T	A	2: 52,093,576	M577K	probably damaging	Het
Sap30	T	C	8: 57,487,248		probably null	Het
Scn2b	T	C	9: 45,125,517	Y108H	probably damaging	Het
Senp2	C	T	16: 22,014,199	T79I	probably damaging	Het
Serpinb2	T	C	1: 107,523,813	V232A	probably damaging	Het
Sgpp2	T	A	1: 78,416,951	L197Q	probably damaging	Het
Slc27a4	T	C	2: 29,810,941	W320R	probably damaging	Het
Soga1	C	T	2: 157,022,827	G1154S	probably benign	Het
Tgm4	T	C	9: 123,061,770	I54T	probably damaging	Het
Thbs4	T	A	13: 92,790,879	D34V	probably benign	Het
Tmem176b	G	A	6: 48,836,333	T64I	probably damaging	Het
Tmem56	T	G	3: 121,207,421	I188L	probably benign	Het
Tmod2	T	C	9: 75,577,242	E248G	probably benign	Het
Ttc6	T	A	12: 57,737,693	D1849E	probably benign	Het
Ttn	T	C	2: 76,785,538	D8360G	possibly damaging	Het
Unc80	A	G	1: 66,640,552	E2094G	possibly damaging	Het
Vmn2r18	A	T	5: 151,584,695	D321E	probably damaging	Het

Other mutations in Cul9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Cul9	APN	17	46525709	missense	probably damaging	1.00
IGL00330:Cul9	APN	17	46510841	splice site	probably benign
IGL00726:Cul9	APN	17	46528096	missense	probably damaging	1.00
IGL01020:Cul9	APN	17	46539023	missense	probably damaging	1.00
IGL01358:Cul9	APN	17	46538314	missense	probably damaging	1.00
IGL01410:Cul9	APN	17	46528646	missense	probably damaging	0.99
IGL01781:Cul9	APN	17	46539304	missense	probably benign
IGL01873:Cul9	APN	17	46502452	missense	probably damaging	0.99
IGL02117:Cul9	APN	17	46540375	missense	probably benign	0.00
IGL02300:Cul9	APN	17	46521032	splice site	probably benign
IGL02426:Cul9	APN	17	46523258	missense	possibly damaging	0.95
IGL02427:Cul9	APN	17	46502632	missense	possibly damaging	0.69
IGL02496:Cul9	APN	17	46540376	missense	possibly damaging	0.72
IGL03008:Cul9	APN	17	46502697	splice site	probably benign
IGL03059:Cul9	APN	17	46538987	missense	probably damaging	0.98
IGL03302:Cul9	APN	17	46526640	missense	probably damaging	0.98
bottlenose	UTSW	17	46500844	missense	possibly damaging	0.79
flipper	UTSW	17	46525892	missense	probably benign	0.05
orca	UTSW	17	46525135	missense	probably damaging	1.00
FR4340:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4449:Cul9	UTSW	17	46500856	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500846	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500858	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500848	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500850	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500856	small insertion	probably benign
R0012:Cul9	UTSW	17	46538510	missense	probably benign	0.26
R0079:Cul9	UTSW	17	46537663	nonsense	probably null
R0143:Cul9	UTSW	17	46526410	missense	possibly damaging	0.65
R0390:Cul9	UTSW	17	46528589	missense	probably benign	0.34
R0401:Cul9	UTSW	17	46541704	missense	probably damaging	1.00
R0529:Cul9	UTSW	17	46520468	splice site	probably benign
R0815:Cul9	UTSW	17	46537822	splice site	probably null
R0863:Cul9	UTSW	17	46537822	splice site	probably null
R0972:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1173:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1216:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1217:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1261:Cul9	UTSW	17	46525782	missense	probably damaging	1.00
R1278:Cul9	UTSW	17	46500849	small deletion	probably benign
R1281:Cul9	UTSW	17	46511534	missense	probably damaging	1.00
R1349:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1372:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1482:Cul9	UTSW	17	46508547	missense	probably damaging	0.99
R1491:Cul9	UTSW	17	46538564	nonsense	probably null
R1618:Cul9	UTSW	17	46525892	missense	probably benign	0.05
R1641:Cul9	UTSW	17	46543560	missense	possibly damaging	0.96
R1679:Cul9	UTSW	17	46521156	missense	possibly damaging	0.90
R1771:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R1803:Cul9	UTSW	17	46503097	missense	probably damaging	1.00
R2020:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R2046:Cul9	UTSW	17	46543733	missense	probably damaging	1.00
R2088:Cul9	UTSW	17	46526649	missense	probably damaging	1.00
R2415:Cul9	UTSW	17	46543438	missense	probably benign
R2925:Cul9	UTSW	17	46510981	missense	probably benign	0.08
R2964:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R2965:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R3690:Cul9	UTSW	17	46504031	splice site	probably null
R3847:Cul9	UTSW	17	46525135	missense	probably damaging	1.00
R4437:Cul9	UTSW	17	46502159	missense	probably damaging	1.00
R4470:Cul9	UTSW	17	46538336	missense	probably benign	0.00
R4540:Cul9	UTSW	17	46503089	missense	probably null	0.98
R4555:Cul9	UTSW	17	46501829	missense	possibly damaging	0.82
R4604:Cul9	UTSW	17	46530146	missense	probably damaging	0.99
R4646:Cul9	UTSW	17	46539017	nonsense	probably null
R4799:Cul9	UTSW	17	46500844	missense	possibly damaging	0.79
R4822:Cul9	UTSW	17	46530051	missense	probably benign	0.01
R4964:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R4965:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R5027:Cul9	UTSW	17	46500782	missense	probably damaging	0.99
R5185:Cul9	UTSW	17	46525832	missense	possibly damaging	0.95
R5237:Cul9	UTSW	17	46543467	missense	probably benign	0.00
R5278:Cul9	UTSW	17	46510873	missense	probably damaging	1.00
R5361:Cul9	UTSW	17	46500849	small deletion	probably benign
R5455:Cul9	UTSW	17	46510846	splice site	probably null
R5592:Cul9	UTSW	17	46520591	missense	probably benign	0.00
R5597:Cul9	UTSW	17	46502665	missense	possibly damaging	0.56
R5613:Cul9	UTSW	17	46503844	missense	probably damaging	1.00
R6122:Cul9	UTSW	17	46521928	missense	possibly damaging	0.72
R6135:Cul9	UTSW	17	46521453	missense	probably benign
R6352:Cul9	UTSW	17	46511315	missense	probably benign	0.00
R6376:Cul9	UTSW	17	46508563	missense	probably damaging	1.00
R6868:Cul9	UTSW	17	46522183	missense	possibly damaging	0.73
R6898:Cul9	UTSW	17	46511026	missense	possibly damaging	0.87
R7090:Cul9	UTSW	17	46500839	missense	probably damaging	0.96
R7193:Cul9	UTSW	17	46538497	missense	probably damaging	0.98
R7221:Cul9	UTSW	17	46528565	missense	probably damaging	0.99
R7291:Cul9	UTSW	17	46540433	missense	probably benign	0.00
R7320:Cul9	UTSW	17	46510909	missense	possibly damaging	0.80
R7348:Cul9	UTSW	17	46510993	missense	possibly damaging	0.89
R7463:Cul9	UTSW	17	46520476	splice site	probably null
R7480:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R7573:Cul9	UTSW	17	46519910	missense	probably benign
R7582:Cul9	UTSW	17	46510979	missense	probably damaging	1.00
R7605:Cul9	UTSW	17	46541732	missense	probably damaging	0.99
R7684:Cul9	UTSW	17	46509889	missense	probably damaging	1.00
R7830:Cul9	UTSW	17	46540311	missense	probably benign	0.37
R7834:Cul9	UTSW	17	46525704	splice site	probably null
R8131:Cul9	UTSW	17	46511242	missense	probably damaging	1.00
R8192:Cul9	UTSW	17	46538347	missense	probably benign	0.01
R8231:Cul9	UTSW	17	46520501	missense	probably damaging	0.99
R8248:Cul9	UTSW	17	46530014	missense	probably damaging	0.99
R8504:Cul9	UTSW	17	46503580	missense	probably damaging	1.00
R8550:Cul9	UTSW	17	46519846	missense	probably damaging	1.00
RF011:Cul9	UTSW	17	46500848	small insertion	probably benign
RF016:Cul9	UTSW	17	46500863	nonsense	probably null
RF026:Cul9	UTSW	17	46500869	nonsense	probably null
RF027:Cul9	UTSW	17	46500848	small insertion	probably benign
RF030:Cul9	UTSW	17	46500869	small insertion	probably benign
RF033:Cul9	UTSW	17	46500854	small insertion	probably benign
RF039:Cul9	UTSW	17	46500854	small insertion	probably benign
RF041:Cul9	UTSW	17	46500854	nonsense	probably null
RF042:Cul9	UTSW	17	46540615	frame shift	probably null
RF057:Cul9	UTSW	17	46500863	nonsense	probably null
Z1176:Cul9	UTSW	17	46520576	nonsense	probably null
Z1176:Cul9	UTSW	17	46520585	nonsense	probably null
Z1177:Cul9	UTSW	17	46537797	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CTCTTACCAGCATCATGGGC -3'
(R):5'- CATCTCCTCATGTGGCTGTCAG -3'

Sequencing Primer
(F):5'- AGCATCATGGGCTGCCAGAG -3'
(R):5'- AGAGGTCTACGCCAACTGC -3'

Posted On

2014-09-17