Incidental Mutation 'R2057:Grin1'
ID228237
Institutional Source Beutler Lab
Gene Symbol Grin1
Ensembl Gene ENSMUSG00000026959
Gene Nameglutamate receptor, ionotropic, NMDA1 (zeta 1)
SynonymsRgsc174, M100174, NR1, GluRzeta1, NMDAR1, Nmdar
MMRRC Submission 040062-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2057 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25291181-25319187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25316820 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 110 (T110S)
Ref Sequence ENSEMBL: ENSMUSP00000109949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028335] [ENSMUST00000114307] [ENSMUST00000114308] [ENSMUST00000114310] [ENSMUST00000114312] [ENSMUST00000114314] [ENSMUST00000114317] [ENSMUST00000114318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028335
AA Change: T110S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028335
Gene: ENSMUSG00000026959
AA Change: T110S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 6.6e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.5e-18 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114307
AA Change: T110S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109946
Gene: ENSMUSG00000026959
AA Change: T110S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114308
AA Change: T110S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109947
Gene: ENSMUSG00000026959
AA Change: T110S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114310
AA Change: T110S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109949
Gene: ENSMUSG00000026959
AA Change: T110S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 39 299 3.6e-24 PFAM
Blast:PBPe 352 420 9e-37 BLAST
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 8.4e-17 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114312
AA Change: T110S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109951
Gene: ENSMUSG00000026959
AA Change: T110S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 5.9e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114314
AA Change: T110S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109953
Gene: ENSMUSG00000026959
AA Change: T110S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1.1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.3e-19 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114317
AA Change: T110S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109956
Gene: ENSMUSG00000026959
AA Change: T110S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 7.7e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114318
AA Change: T110S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109957
Gene: ENSMUSG00000026959
AA Change: T110S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8.4e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.4e-19 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155627
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a critical subunit of N-methyl-D-aspartate receptors, members of the glutamate receptor channel superfamily which are heteromeric protein complexes with multiple subunits arranged to form a ligand-gated ion channel. These subunits play a key role in the plasticity of synapses, which is believed to underlie memory and learning. Cell-specific factors are thought to control expression of different isoforms, possibly contributing to the functional diversity of the subunits. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutants lack whisker patterns in brain cortex, are ataxic and die neonatally of respiratory failure. Hypomorph mutants exhibit hyperactivity, stereotypy, and impaired social/sexual interactions. Mice homozygous for an ENU-induced allele exhibit abnormal behavior and neuron physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Abcc2 A G 19: 43,818,038 K764E probably damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apob A T 12: 8,002,164 R1202* probably null Het
Arfgap3 G T 15: 83,310,300 D389E probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Atoh8 T C 6: 72,235,128 K13E probably damaging Het
Bicral G T 17: 46,824,888 N465K possibly damaging Het
Bves T A 10: 45,343,135 Y110N probably damaging Het
C4b A G 17: 34,728,620 Y1695H probably damaging Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Caskin1 G T 17: 24,496,459 G93V probably damaging Het
Cd34 T C 1: 194,959,142 V292A probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdh16 C A 8: 104,621,965 G144* probably null Het
Chaf1b T A 16: 93,894,907 H280Q probably damaging Het
Chpf2 G A 5: 24,591,222 G389R probably damaging Het
Crb1 T C 1: 139,314,750 Y330C probably damaging Het
Cux2 A T 5: 121,869,504 V698E probably benign Het
Dhtkd1 A G 2: 5,942,619 V18A unknown Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Enpp1 C G 10: 24,660,192 A437P probably damaging Het
Fat2 C T 11: 55,281,860 V2676I possibly damaging Het
Fzd2 A G 11: 102,605,933 D401G probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gnai3 C T 3: 108,112,496 V233I probably benign Het
Golim4 T A 3: 75,894,887 D366V possibly damaging Het
Grin2a A G 16: 9,669,744 V430A probably benign Het
Gstp3 G A 19: 4,059,282 T5I probably damaging Het
Il17rb T A 14: 29,997,154 M324L probably benign Het
Jmy A G 13: 93,459,703 Y473H probably damaging Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Lmo7 G C 14: 101,887,178 A358P probably damaging Het
Mdh1b T C 1: 63,721,582 I107V probably benign Het
Mlkl T C 8: 111,333,610 Q48R probably benign Het
Myh2 G A 11: 67,188,839 probably null Het
Naip1 T A 13: 100,425,573 Q1028L probably damaging Het
Ncald T A 15: 37,397,179 I86F possibly damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Olfr59 A G 11: 74,288,826 Y60C probably damaging Het
Olfr823 A T 10: 130,111,990 S267T probably benign Het
Pak1 T A 7: 97,907,797 probably null Het
Parpbp T A 10: 88,124,962 M221L probably benign Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Phf19 G T 2: 34,899,608 R367S probably benign Het
Plcl2 A G 17: 50,668,111 probably null Het
Plxnb1 A T 9: 109,109,226 I1283F possibly damaging Het
Pramel6 T A 2: 87,508,715 N86K possibly damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prpf40a A T 2: 53,144,839 I779K probably damaging Het
Ptpn20 A T 14: 33,630,985 E227V probably damaging Het
Rad54b C T 4: 11,606,088 R499C probably benign Het
Rarg C A 15: 102,239,504 A291S probably damaging Het
Rnf169 A T 7: 99,925,408 L660Q probably damaging Het
Scn4a A G 11: 106,335,724 V670A probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc35g2 G A 9: 100,553,276 A114V probably damaging Het
Slc7a14 A T 3: 31,237,496 V211E probably damaging Het
Snrpn A T 7: 59,987,456 H37Q possibly damaging Het
Spock3 T A 8: 63,245,170 C185* probably null Het
Tbc1d4 A G 14: 101,477,155 S627P probably damaging Het
Tgoln1 T C 6: 72,615,670 T276A probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tnpo2 T C 8: 85,050,113 L483P probably damaging Het
Tpte T A 8: 22,318,339 D163E probably benign Het
Trim36 A T 18: 46,196,162 D70E probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Wdr90 T C 17: 25,855,199 T691A probably benign Het
Zdhhc8 A G 16: 18,228,346 S118P probably damaging Het
Zfp438 T C 18: 5,214,085 E291G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Other mutations in Grin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Grin1 APN 2 25296967 missense possibly damaging 0.93
IGL01627:Grin1 APN 2 25318697 missense probably damaging 1.00
IGL02039:Grin1 APN 2 25305342 missense probably damaging 0.98
IGL02074:Grin1 APN 2 25298502 missense possibly damaging 0.81
IGL02083:Grin1 APN 2 25298501 missense possibly damaging 0.93
IGL03334:Grin1 APN 2 25298393 critical splice donor site probably null
IGL03349:Grin1 APN 2 25310436 missense probably benign
PIT4283001:Grin1 UTSW 2 25297852 missense probably damaging 1.00
R0038:Grin1 UTSW 2 25297459 missense probably null 0.82
R0829:Grin1 UTSW 2 25298448 missense probably benign 0.08
R1454:Grin1 UTSW 2 25292430 nonsense probably null
R1550:Grin1 UTSW 2 25305131 missense probably benign 0.01
R1969:Grin1 UTSW 2 25297915 missense probably benign 0.01
R2424:Grin1 UTSW 2 25318652 missense probably null 1.00
R2877:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R2878:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R3420:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3422:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3958:Grin1 UTSW 2 25313453 missense probably damaging 1.00
R4222:Grin1 UTSW 2 25297320 intron probably benign
R4224:Grin1 UTSW 2 25297320 intron probably benign
R4225:Grin1 UTSW 2 25297320 intron probably benign
R4409:Grin1 UTSW 2 25310439 missense possibly damaging 0.75
R4723:Grin1 UTSW 2 25294470 missense probably benign 0.30
R4775:Grin1 UTSW 2 25292463 missense possibly damaging 0.92
R4783:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4784:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4785:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4829:Grin1 UTSW 2 25318724 missense possibly damaging 0.47
R4915:Grin1 UTSW 2 25298553 intron probably benign
R5064:Grin1 UTSW 2 25303831 intron probably benign
R5103:Grin1 UTSW 2 25310421 missense probably benign
R5125:Grin1 UTSW 2 25296827 intron probably benign
R5215:Grin1 UTSW 2 25303907 missense probably benign 0.00
R5419:Grin1 UTSW 2 25298273 splice site probably null
R6119:Grin1 UTSW 2 25305158 missense probably damaging 1.00
R6616:Grin1 UTSW 2 25292110 missense possibly damaging 0.82
R6894:Grin1 UTSW 2 25295817 missense probably damaging 1.00
R7101:Grin1 UTSW 2 25296635 missense probably damaging 0.98
R7137:Grin1 UTSW 2 25313538 missense probably benign
R7544:Grin1 UTSW 2 25305074 missense probably benign 0.05
R7693:Grin1 UTSW 2 25318667 missense possibly damaging 0.93
R7872:Grin1 UTSW 2 25298190 missense probably benign 0.01
R7986:Grin1 UTSW 2 25295829 missense probably damaging 1.00
X0026:Grin1 UTSW 2 25305098 missense probably benign 0.22
Z1176:Grin1 UTSW 2 25297907 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCACAGGCCTGAATATTAGTGC -3'
(R):5'- ACAAATGGCATCACCTGGGC -3'

Sequencing Primer
(F):5'- ATACCTGTACCTGTGAGACCTAGTG -3'
(R):5'- CATCACCTGGGCCCCTG -3'
Posted On2014-09-17