Mutagenetix > Incidental Mutation

Incidental Mutation 'R0153:Prdm2'

22825

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

038436-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0153 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 143133768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 984 (P984L)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

AlphaFold

A2A7B5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105778
AA Change: P984L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: P984L

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197026

Meta Mutation Damage Score

0.2625

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

97% (99/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	G	T	9: 94,524,480	D291E	probably benign	Het
2010300C02Rik	A	G	1: 37,624,639	V726A	probably benign	Het
Abcb9	T	C	5: 124,080,056	M406V	probably benign	Het
Adar	T	C	3: 89,730,814	S2P	probably benign	Het
Adgre1	T	A	17: 57,443,939	S538T	possibly damaging	Het
Alms1	T	A	6: 85,641,381	I2803N	possibly damaging	Het
Amn1	G	T	6: 149,188,593		probably benign	Het
Arid1b	G	A	17: 5,342,932	A2246T	probably damaging	Het
BC024139	T	C	15: 76,121,747	E418G	probably damaging	Het
Bok	A	G	1: 93,686,517	D24G	probably damaging	Het
Cabp2	T	C	19: 4,084,913		probably benign	Het
Ccdc141	C	A	2: 77,165,238		probably benign	Het
Ccdc178	T	C	18: 22,150,435	T13A	probably benign	Het
Ccdc42	G	T	11: 68,587,650	V33F	possibly damaging	Het
Clcn7	G	A	17: 25,149,202		probably benign	Het
Cluh	A	G	11: 74,657,350		probably benign	Het
Cr1l	A	T	1: 195,114,856		probably benign	Het
Csnk1g3	T	A	18: 53,918,789		probably benign	Het
Depdc5	T	C	5: 32,933,937		probably benign	Het
Dgkh	A	C	14: 78,570,129	Y1149*	probably null	Het
Dnaic1	A	G	4: 41,635,162		probably benign	Het
Efcab2	A	G	1: 178,474,886	E65G	possibly damaging	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Fam71e2	A	T	7: 4,770,287	L177Q	probably damaging	Het
Fgfr4	A	G	13: 55,161,385		probably benign	Het
Gm10720	A	C	9: 3,015,787	S44R	probably null	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm6471	A	T	7: 142,831,631		noncoding transcript	Het
Gm8994	A	T	6: 136,328,844	D101V	probably damaging	Het
Hnrnpm	C	T	17: 33,646,515	R724Q	probably damaging	Het
Homer1	C	T	13: 93,391,746	T117I	possibly damaging	Het
Hoxd4	A	T	2: 74,727,457	Q60L	probably damaging	Het
Ift172	T	C	5: 31,260,624	R1274G	probably benign	Het
Ino80d	A	G	1: 63,058,318	S806P	probably damaging	Het
Itga10	T	C	3: 96,653,700	V627A	probably benign	Het
Itgb2l	A	G	16: 96,437,369	Y77H	possibly damaging	Het
Kel	A	T	6: 41,701,943	H195Q	probably benign	Het
Klhdc7a	A	G	4: 139,967,271	S122P	possibly damaging	Het
Krt71	T	A	15: 101,734,706	I456F	possibly damaging	Het
Lats1	T	A	10: 7,691,575	S37T	probably damaging	Het
Lrp1b	T	A	2: 41,123,019	H1858L	possibly damaging	Het
Matk	A	T	10: 81,262,842	T461S	probably benign	Het
Meikin	A	G	11: 54,409,642		probably benign	Het
Muc6	T	C	7: 141,634,116	Q2832R	possibly damaging	Het
Myo10	T	C	15: 25,781,238	F194L	possibly damaging	Het
Nbas	G	A	12: 13,273,876		probably benign	Het
Nme4	A	G	17: 26,093,857		probably null	Het
Olfr1136	A	G	2: 87,693,604	S93P	probably benign	Het
Olfr1217	T	A	2: 89,023,196	N269I	probably benign	Het
Olfr1340	A	T	4: 118,726,333	I29F	possibly damaging	Het
Olfr851	T	A	9: 19,496,937	L63H	probably damaging	Het
Olfr954	T	C	9: 39,461,671	V80A	probably damaging	Het
Pacsin2	T	C	15: 83,377,661	Q473R	probably benign	Het
Patz1	A	G	11: 3,293,288	H427R	probably damaging	Het
Pkp3	A	G	7: 141,083,343	Y367C	probably damaging	Het
Rev3l	T	A	10: 39,874,128	C3091*	probably null	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Rpl5	T	C	5: 107,904,757	F140L	probably benign	Het
Sec24a	A	C	11: 51,700,826	I1014M	probably benign	Het
Serpinb11	A	G	1: 107,372,203	H93R	probably benign	Het
Shank2	C	A	7: 144,070,135	H286N	probably benign	Het
Sipa1l2	G	T	8: 125,421,898	Q1651K	probably damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc30a5	A	T	13: 100,826,494	F75L	possibly damaging	Het
Slco1a1	G	T	6: 141,910,701		probably benign	Het
Smg5	C	T	3: 88,353,872		probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Taf8	A	T	17: 47,498,252		probably benign	Het
Tarsl2	A	G	7: 65,684,081	D617G	probably damaging	Het
Tbc1d5	A	T	17: 50,984,687		probably benign	Het
Tfcp2	C	G	15: 100,514,827	E315Q	probably damaging	Het
Tmf1	A	T	6: 97,170,384	S540R	probably damaging	Het
Tmprss4	T	C	9: 45,184,336	Q70R	probably benign	Het
Trip13	G	T	13: 73,920,064	A266E	possibly damaging	Het
Ttc24	T	A	3: 88,074,927		probably benign	Het
Ttll5	T	A	12: 85,831,966	I49N	probably damaging	Het
Ube2ql1	A	T	13: 69,738,592	M250K	possibly damaging	Het
Vmn1r87	A	T	7: 13,132,284	D25E	probably damaging	Het
Vmn2r84	A	G	10: 130,392,008	Y120H	probably benign	Het
Wdr6	G	A	9: 108,575,242	R481C	probably damaging	Het
Wdr60	A	G	12: 116,232,636	V497A	probably benign	Het
Zcchc6	G	A	13: 59,782,336	R962*	probably null	Het
Zdhhc17	A	T	10: 110,955,094	Y371*	probably null	Het
Zfp292	T	C	4: 34,811,185	N620D	probably benign	Het
Zfp932	T	A	5: 110,006,968	Y11N	probably benign	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R8887:Prdm2	UTSW	4	143134201	missense	probably damaging	1.00
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
R9518:Prdm2	UTSW	4	143134009	missense	possibly damaging	0.94
R9546:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
R9547:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACCACAGATGACACTGCTGAGAG -3'
(R):5'- GCCAGATCCTGAACTTGCTACTGAC -3'

Sequencing Primer
(F):5'- gaagaggaagagaaggaagagg -3'
(R):5'- TCGAGTTGCTCAGCCCC -3'

Posted On

2013-04-16