Incidental Mutation 'R2057:Dmbt1'
ID 228262
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms CRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission 040062-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R2057 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 131032053-131121630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 131106170 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1381 (A1381T)
Ref Sequence ENSEMBL: ENSMUSP00000146685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000084509
AA Change: A1370T

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: A1370T

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208311
AA Change: A1381T

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000213064
AA Change: A1207T

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1505 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Abcc2 A G 19: 43,818,038 K764E probably damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apob A T 12: 8,002,164 R1202* probably null Het
Arfgap3 G T 15: 83,310,300 D389E probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Atoh8 T C 6: 72,235,128 K13E probably damaging Het
Bicral G T 17: 46,824,888 N465K possibly damaging Het
Bves T A 10: 45,343,135 Y110N probably damaging Het
C4b A G 17: 34,728,620 Y1695H probably damaging Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Caskin1 G T 17: 24,496,459 G93V probably damaging Het
Cd34 T C 1: 194,959,142 V292A probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdh16 C A 8: 104,621,965 G144* probably null Het
Chaf1b T A 16: 93,894,907 H280Q probably damaging Het
Chpf2 G A 5: 24,591,222 G389R probably damaging Het
Crb1 T C 1: 139,314,750 Y330C probably damaging Het
Cux2 A T 5: 121,869,504 V698E probably benign Het
Dhtkd1 A G 2: 5,942,619 V18A unknown Het
Enpp1 C G 10: 24,660,192 A437P probably damaging Het
Fat2 C T 11: 55,281,860 V2676I possibly damaging Het
Fzd2 A G 11: 102,605,933 D401G probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gnai3 C T 3: 108,112,496 V233I probably benign Het
Golim4 T A 3: 75,894,887 D366V possibly damaging Het
Grin1 T A 2: 25,316,820 T110S probably damaging Het
Grin2a A G 16: 9,669,744 V430A probably benign Het
Gstp3 G A 19: 4,059,282 T5I probably damaging Het
Il17rb T A 14: 29,997,154 M324L probably benign Het
Jmy A G 13: 93,459,703 Y473H probably damaging Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Lmo7 G C 14: 101,887,178 A358P probably damaging Het
Mdh1b T C 1: 63,721,582 I107V probably benign Het
Mlkl T C 8: 111,333,610 Q48R probably benign Het
Myh2 G A 11: 67,188,839 probably null Het
Naip1 T A 13: 100,425,573 Q1028L probably damaging Het
Ncald T A 15: 37,397,179 I86F possibly damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Olfr59 A G 11: 74,288,826 Y60C probably damaging Het
Olfr823 A T 10: 130,111,990 S267T probably benign Het
Pak1 T A 7: 97,907,797 probably null Het
Parpbp T A 10: 88,124,962 M221L probably benign Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Phf19 G T 2: 34,899,608 R367S probably benign Het
Plcl2 A G 17: 50,668,111 probably null Het
Plxnb1 A T 9: 109,109,226 I1283F possibly damaging Het
Pramel6 T A 2: 87,508,715 N86K possibly damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prpf40a A T 2: 53,144,839 I779K probably damaging Het
Ptpn20 A T 14: 33,630,985 E227V probably damaging Het
Rad54b C T 4: 11,606,088 R499C probably benign Het
Rarg C A 15: 102,239,504 A291S probably damaging Het
Rnf169 A T 7: 99,925,408 L660Q probably damaging Het
Scn4a A G 11: 106,335,724 V670A probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc35g2 G A 9: 100,553,276 A114V probably damaging Het
Slc7a14 A T 3: 31,237,496 V211E probably damaging Het
Snrpn A T 7: 59,987,456 H37Q possibly damaging Het
Spock3 T A 8: 63,245,170 C185* probably null Het
Tbc1d4 A G 14: 101,477,155 S627P probably damaging Het
Tgoln1 T C 6: 72,615,670 T276A probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tnpo2 T C 8: 85,050,113 L483P probably damaging Het
Tpte T A 8: 22,318,339 D163E probably benign Het
Trim36 A T 18: 46,196,162 D70E probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Wdr90 T C 17: 25,855,199 T691A probably benign Het
Zdhhc8 A G 16: 18,228,346 S118P probably damaging Het
Zfp438 T C 18: 5,214,085 E291G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
cavity UTSW 7 131112236 missense unknown
lacunar UTSW 7 131097631 missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 131037890 missense probably benign 0.16
BB015:Dmbt1 UTSW 7 131037890 missense probably benign 0.16
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 splice site probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
R7428:Dmbt1 UTSW 7 131108463 missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131079511 critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131066462 missense unknown
R7513:Dmbt1 UTSW 7 131090512 missense unknown
R7553:Dmbt1 UTSW 7 131104867 missense unknown
R7567:Dmbt1 UTSW 7 131061363 splice site probably null
R7584:Dmbt1 UTSW 7 131088751 nonsense probably null
R7736:Dmbt1 UTSW 7 131116896 missense unknown
R7758:Dmbt1 UTSW 7 131121197 missense unknown
R7928:Dmbt1 UTSW 7 131037890 missense probably benign 0.16
R8080:Dmbt1 UTSW 7 131088770 missense unknown
R8098:Dmbt1 UTSW 7 131108459 nonsense probably null
R8125:Dmbt1 UTSW 7 131099223 missense unknown
R8177:Dmbt1 UTSW 7 131106432 missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 131085417 critical splice donor site probably null
R8366:Dmbt1 UTSW 7 131066600 missense unknown
R8378:Dmbt1 UTSW 7 131106465 missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 131082587 missense unknown
R8400:Dmbt1 UTSW 7 131082587 missense unknown
R8445:Dmbt1 UTSW 7 131090380 missense unknown
R8450:Dmbt1 UTSW 7 131085417 critical splice donor site probably null
R8511:Dmbt1 UTSW 7 131102012 missense unknown
R8688:Dmbt1 UTSW 7 131058254 missense unknown
R8850:Dmbt1 UTSW 7 131090404 missense unknown
R8852:Dmbt1 UTSW 7 131041123 missense unknown
R8871:Dmbt1 UTSW 7 131116868 missense unknown
R8943:Dmbt1 UTSW 7 131119643 missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 131037881 missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 131112069 missense unknown
R9020:Dmbt1 UTSW 7 131111058 missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 131116689 missense unknown
R9230:Dmbt1 UTSW 7 131037912 missense probably benign 0.01
R9304:Dmbt1 UTSW 7 131099125 missense unknown
R9377:Dmbt1 UTSW 7 131093102 missense unknown
R9428:Dmbt1 UTSW 7 131066478 missense unknown
R9474:Dmbt1 UTSW 7 131074257 missense unknown
R9573:Dmbt1 UTSW 7 131056180 critical splice donor site probably null
R9675:Dmbt1 UTSW 7 131110923 missense probably damaging 0.98
R9689:Dmbt1 UTSW 7 131058285 missense unknown
R9781:Dmbt1 UTSW 7 131037869 missense probably benign 0.00
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 131088812 missense unknown
Z1177:Dmbt1 UTSW 7 131082485 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCCTGAAGATTCTTTGTGC -3'
(R):5'- ATCCAGGACAATGAGCCCTG -3'

Sequencing Primer
(F):5'- CCCAGGGTGCAGAAACTTTG -3'
(R):5'- AATGAGCCCTGAGCCCTGAC -3'
Posted On 2014-09-17