Incidental Mutation 'R2057:Enpp1'
ID 228274
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms PC-1, E-NPP1, Npps, Pca, Pdnp1, CD203c, twy, NPP1, 4833416E15Rik, Pca-1, Ly-41
MMRRC Submission 040062-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R2057 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 24513812-24588057 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 24536090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 437 (A437P)
Ref Sequence ENSEMBL: ENSMUSP00000101159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105520
AA Change: A437P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: A437P

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135846
AA Change: A437P

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: A437P

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,806,477 (GRCm39) K764E probably damaging Het
Abcg2 T C 6: 58,667,525 (GRCm39) V129A probably benign Het
Adgrf5 A G 17: 43,739,477 (GRCm39) Y72C possibly damaging Het
Ago1 C T 4: 126,337,021 (GRCm39) R228H probably damaging Het
Ano1 A G 7: 144,201,789 (GRCm39) V334A probably damaging Het
Apob A T 12: 8,052,164 (GRCm39) R1202* probably null Het
Arfgap3 G T 15: 83,194,501 (GRCm39) D389E probably benign Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Atoh8 T C 6: 72,212,112 (GRCm39) K13E probably damaging Het
Bicral G T 17: 47,135,814 (GRCm39) N465K possibly damaging Het
Bves T A 10: 45,219,231 (GRCm39) Y110N probably damaging Het
C4b A G 17: 34,947,594 (GRCm39) Y1695H probably damaging Het
Cage1 A G 13: 38,207,356 (GRCm39) V163A probably benign Het
Canx T C 11: 50,195,252 (GRCm39) N272S probably damaging Het
Caskin1 G T 17: 24,715,433 (GRCm39) G93V probably damaging Het
Cd34 T C 1: 194,641,450 (GRCm39) V292A probably damaging Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Cdh16 C A 8: 105,348,597 (GRCm39) G144* probably null Het
Chaf1b T A 16: 93,691,795 (GRCm39) H280Q probably damaging Het
Chpf2 G A 5: 24,796,220 (GRCm39) G389R probably damaging Het
Crb1 T C 1: 139,242,488 (GRCm39) Y330C probably damaging Het
Cux2 A T 5: 122,007,567 (GRCm39) V698E probably benign Het
Dhtkd1 A G 2: 5,947,430 (GRCm39) V18A unknown Het
Dmbt1 G A 7: 130,707,900 (GRCm39) A1381T possibly damaging Het
Fat2 C T 11: 55,172,686 (GRCm39) V2676I possibly damaging Het
Fzd2 A G 11: 102,496,759 (GRCm39) D401G probably damaging Het
Gcm2 T C 13: 41,263,430 (GRCm39) M1V probably null Het
Gnai3 C T 3: 108,019,812 (GRCm39) V233I probably benign Het
Golim4 T A 3: 75,802,194 (GRCm39) D366V possibly damaging Het
Grin1 T A 2: 25,206,832 (GRCm39) T110S probably damaging Het
Grin2a A G 16: 9,487,608 (GRCm39) V430A probably benign Het
Gstp3 G A 19: 4,109,282 (GRCm39) T5I probably damaging Het
Il17rb T A 14: 29,719,111 (GRCm39) M324L probably benign Het
Jmy A G 13: 93,596,211 (GRCm39) Y473H probably damaging Het
Khdc1b A G 1: 21,454,534 (GRCm39) D79G probably benign Het
Kremen2 T C 17: 23,961,691 (GRCm39) E272G possibly damaging Het
Lmo7 G C 14: 102,124,614 (GRCm39) A358P probably damaging Het
Mdh1b T C 1: 63,760,741 (GRCm39) I107V probably benign Het
Mlkl T C 8: 112,060,242 (GRCm39) Q48R probably benign Het
Myh2 G A 11: 67,079,665 (GRCm39) probably null Het
Naip1 T A 13: 100,562,081 (GRCm39) Q1028L probably damaging Het
Ncald T A 15: 37,397,423 (GRCm39) I86F possibly damaging Het
Nid1 A C 13: 13,675,058 (GRCm39) H926P probably benign Het
Nlrp9a T A 7: 26,256,787 (GRCm39) I46K possibly damaging Het
Or1p1 A G 11: 74,179,652 (GRCm39) Y60C probably damaging Het
Or9r3 A T 10: 129,947,859 (GRCm39) S267T probably benign Het
Pak1 T A 7: 97,557,004 (GRCm39) probably null Het
Parpbp T A 10: 87,960,824 (GRCm39) M221L probably benign Het
Pde12 T C 14: 26,390,035 (GRCm39) I225V probably benign Het
Phf19 G T 2: 34,789,620 (GRCm39) R367S probably benign Het
Plcl2 A G 17: 50,975,139 (GRCm39) probably null Het
Plxnb1 A T 9: 108,938,294 (GRCm39) I1283F possibly damaging Het
Pramel6 T A 2: 87,339,059 (GRCm39) N86K possibly damaging Het
Prkdc A G 16: 15,545,469 (GRCm39) T1862A probably benign Het
Prpf40a A T 2: 53,034,851 (GRCm39) I779K probably damaging Het
Prss3b G A 6: 41,009,315 (GRCm39) T173I probably benign Het
Ptpn20 A T 14: 33,352,942 (GRCm39) E227V probably damaging Het
Rad54b C T 4: 11,606,088 (GRCm39) R499C probably benign Het
Rarg C A 15: 102,147,939 (GRCm39) A291S probably damaging Het
Rnf169 A T 7: 99,574,615 (GRCm39) L660Q probably damaging Het
Scn4a A G 11: 106,226,550 (GRCm39) V670A probably damaging Het
Serpinb9c A T 13: 33,340,854 (GRCm39) C81* probably null Het
Sik1 A G 17: 32,067,771 (GRCm39) S435P probably benign Het
Slc35g2 G A 9: 100,435,329 (GRCm39) A114V probably damaging Het
Slc7a14 A T 3: 31,291,645 (GRCm39) V211E probably damaging Het
Snrpn A T 7: 59,637,204 (GRCm39) H37Q possibly damaging Het
Spock3 T A 8: 63,698,204 (GRCm39) C185* probably null Het
Tbc1d4 A G 14: 101,714,591 (GRCm39) S627P probably damaging Het
Tgoln1 T C 6: 72,592,653 (GRCm39) T276A probably benign Het
Tmem176b G A 6: 48,813,267 (GRCm39) T64I probably damaging Het
Tnpo2 T C 8: 85,776,742 (GRCm39) L483P probably damaging Het
Tpte T A 8: 22,808,355 (GRCm39) D163E probably benign Het
Trim36 A T 18: 46,329,229 (GRCm39) D70E probably benign Het
Umodl1 G A 17: 31,227,740 (GRCm39) probably null Het
Wdr90 T C 17: 26,074,173 (GRCm39) T691A probably benign Het
Zdhhc8 A G 16: 18,046,210 (GRCm39) S118P probably damaging Het
Zfp438 T C 18: 5,214,085 (GRCm39) E291G probably benign Het
Zfp879 C T 11: 50,723,428 (GRCm39) E543K probably benign Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24,521,325 (GRCm39) missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24,529,929 (GRCm39) missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24,540,512 (GRCm39) missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24,531,754 (GRCm39) missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24,517,859 (GRCm39) missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24,555,083 (GRCm39) splice site probably benign
IGL02691:Enpp1 APN 10 24,587,790 (GRCm39) missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24,536,172 (GRCm39) missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24,531,779 (GRCm39) splice site probably benign
IGL03330:Enpp1 APN 10 24,540,804 (GRCm39) splice site probably benign
IGL03365:Enpp1 APN 10 24,544,923 (GRCm39) missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24,536,181 (GRCm39) critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24,529,848 (GRCm39) missense probably benign 0.16
R0011:Enpp1 UTSW 10 24,545,900 (GRCm39) nonsense probably null
R0201:Enpp1 UTSW 10 24,529,815 (GRCm39) missense probably benign 0.00
R0496:Enpp1 UTSW 10 24,547,950 (GRCm39) missense probably benign 0.18
R1228:Enpp1 UTSW 10 24,521,310 (GRCm39) missense probably benign 0.30
R1536:Enpp1 UTSW 10 24,517,732 (GRCm39) missense probably benign 0.27
R1927:Enpp1 UTSW 10 24,530,786 (GRCm39) missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24,587,702 (GRCm39) critical splice donor site probably null
R2353:Enpp1 UTSW 10 24,527,239 (GRCm39) missense probably benign 0.24
R4077:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4079:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4739:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4740:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4761:Enpp1 UTSW 10 24,517,849 (GRCm39) missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24,537,833 (GRCm39) missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24,523,983 (GRCm39) missense probably benign 0.01
R5140:Enpp1 UTSW 10 24,528,750 (GRCm39) missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24,527,288 (GRCm39) missense probably benign
R5421:Enpp1 UTSW 10 24,545,655 (GRCm39) missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24,530,806 (GRCm39) missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24,530,817 (GRCm39) missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24,523,137 (GRCm39) missense probably benign
R5942:Enpp1 UTSW 10 24,551,966 (GRCm39) nonsense probably null
R6048:Enpp1 UTSW 10 24,536,152 (GRCm39) missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24,533,024 (GRCm39) missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24,517,780 (GRCm39) missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24,523,929 (GRCm39) missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24,545,653 (GRCm39) nonsense probably null
R6793:Enpp1 UTSW 10 24,531,723 (GRCm39) missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24,527,237 (GRCm39) missense probably benign 0.30
R7255:Enpp1 UTSW 10 24,521,213 (GRCm39) missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24,536,059 (GRCm39) missense probably benign 0.01
R7401:Enpp1 UTSW 10 24,521,180 (GRCm39) missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7430:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7526:Enpp1 UTSW 10 24,550,308 (GRCm39) splice site probably null
R7532:Enpp1 UTSW 10 24,551,885 (GRCm39) missense probably benign 0.29
R7789:Enpp1 UTSW 10 24,529,981 (GRCm39) splice site probably null
R8073:Enpp1 UTSW 10 24,555,142 (GRCm39) missense possibly damaging 0.50
R8283:Enpp1 UTSW 10 24,550,554 (GRCm39) missense probably benign 0.25
R8955:Enpp1 UTSW 10 24,544,926 (GRCm39) missense probably benign 0.01
R9494:Enpp1 UTSW 10 24,527,234 (GRCm39) missense probably benign
Z1177:Enpp1 UTSW 10 24,537,840 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATAGGTAAATGGCTACCCTCTC -3'
(R):5'- CCTAACTGAAACGTTGTGTCTTATC -3'

Sequencing Primer
(F):5'- AGGTAAATGGCTACCCTCTCTTCAC -3'
(R):5'- GCAGATCTCTGTGAGCTCAAG -3'
Posted On 2014-09-17