Incidental Mutation 'R2057:Myh2'
ID228283
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 040062-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R2057 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 67188839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably null
Transcript: ENSMUST00000018641
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170159
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Abcc2 A G 19: 43,818,038 K764E probably damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apob A T 12: 8,002,164 R1202* probably null Het
Arfgap3 G T 15: 83,310,300 D389E probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Atoh8 T C 6: 72,235,128 K13E probably damaging Het
Bicral G T 17: 46,824,888 N465K possibly damaging Het
Bves T A 10: 45,343,135 Y110N probably damaging Het
C4b A G 17: 34,728,620 Y1695H probably damaging Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Caskin1 G T 17: 24,496,459 G93V probably damaging Het
Cd34 T C 1: 194,959,142 V292A probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdh16 C A 8: 104,621,965 G144* probably null Het
Chaf1b T A 16: 93,894,907 H280Q probably damaging Het
Chpf2 G A 5: 24,591,222 G389R probably damaging Het
Crb1 T C 1: 139,314,750 Y330C probably damaging Het
Cux2 A T 5: 121,869,504 V698E probably benign Het
Dhtkd1 A G 2: 5,942,619 V18A unknown Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Enpp1 C G 10: 24,660,192 A437P probably damaging Het
Fat2 C T 11: 55,281,860 V2676I possibly damaging Het
Fzd2 A G 11: 102,605,933 D401G probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gnai3 C T 3: 108,112,496 V233I probably benign Het
Golim4 T A 3: 75,894,887 D366V possibly damaging Het
Grin1 T A 2: 25,316,820 T110S probably damaging Het
Grin2a A G 16: 9,669,744 V430A probably benign Het
Gstp3 G A 19: 4,059,282 T5I probably damaging Het
Il17rb T A 14: 29,997,154 M324L probably benign Het
Jmy A G 13: 93,459,703 Y473H probably damaging Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Lmo7 G C 14: 101,887,178 A358P probably damaging Het
Mdh1b T C 1: 63,721,582 I107V probably benign Het
Mlkl T C 8: 111,333,610 Q48R probably benign Het
Naip1 T A 13: 100,425,573 Q1028L probably damaging Het
Ncald T A 15: 37,397,179 I86F possibly damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Olfr59 A G 11: 74,288,826 Y60C probably damaging Het
Olfr823 A T 10: 130,111,990 S267T probably benign Het
Pak1 T A 7: 97,907,797 probably null Het
Parpbp T A 10: 88,124,962 M221L probably benign Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Phf19 G T 2: 34,899,608 R367S probably benign Het
Plcl2 A G 17: 50,668,111 probably null Het
Plxnb1 A T 9: 109,109,226 I1283F possibly damaging Het
Pramel6 T A 2: 87,508,715 N86K possibly damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prpf40a A T 2: 53,144,839 I779K probably damaging Het
Ptpn20 A T 14: 33,630,985 E227V probably damaging Het
Rad54b C T 4: 11,606,088 R499C probably benign Het
Rarg C A 15: 102,239,504 A291S probably damaging Het
Rnf169 A T 7: 99,925,408 L660Q probably damaging Het
Scn4a A G 11: 106,335,724 V670A probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc35g2 G A 9: 100,553,276 A114V probably damaging Het
Slc7a14 A T 3: 31,237,496 V211E probably damaging Het
Snrpn A T 7: 59,987,456 H37Q possibly damaging Het
Spock3 T A 8: 63,245,170 C185* probably null Het
Tbc1d4 A G 14: 101,477,155 S627P probably damaging Het
Tgoln1 T C 6: 72,615,670 T276A probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tnpo2 T C 8: 85,050,113 L483P probably damaging Het
Tpte T A 8: 22,318,339 D163E probably benign Het
Trim36 A T 18: 46,196,162 D70E probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Wdr90 T C 17: 25,855,199 T691A probably benign Het
Zdhhc8 A G 16: 18,228,346 S118P probably damaging Het
Zfp438 T C 18: 5,214,085 E291G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACGTTTGCTTCCCAAGGTG -3'
(R):5'- TGAGCCTTTCATCGAGCTG -3'

Sequencing Primer
(F):5'- CGTTTGCTTCCCAAGGTGAAAAAC -3'
(R):5'- GATGGACTCCTGGGCTAACTTCAAG -3'
Posted On2014-09-17