Mutagenetix > Incidental Mutations

Incidental Mutation 'R2057:Fzd2'

228285

Institutional Source

Beutler Lab

Gene Symbol

Fzd2

Ensembl Gene

ENSMUSG00000050288

Gene Name

frizzled class receptor 2

Synonyms

Mfz10a, Fz10, Mfz10

MMRRC Submission

040062-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.356) question?

Stock #

R2057 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102604396-102608058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102605933 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 401 (D401G)

Ref Sequence

ENSEMBL: ENSMUSP00000091463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057893]

Predicted Effect

probably damaging
Transcript: ENSMUST00000057893
AA Change: D401G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091463
Gene: ENSMUSG00000050288
AA Change: D401G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FRI	43	160	7.47e-74	SMART
low complexity region	176	195	N/A	INTRINSIC
Frizzled	239	563	3.32e-218	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. This gene encodes a protein that is coupled to the beta-catenin canonical signaling pathway. Competition between the wingless-type MMTV integration site family, member 3A and wingless-type MMTV integration site family, member 5A gene products for binding of this protein is thought to regulate the beta-catenin-dependent and -independent pathways. [provided by RefSeq, Dec 2010]
PHENOTYPE: About 50% of mice homozygous for a reporter allele display a cleft palate and die as neonates; the remaining 50% survive exhibiting a variable degree of postnatal runting and reduced olfactory sensitivity to various odorants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	G	A	6: 41,032,381	T173I	probably benign	Het
Abcc2	A	G	19: 43,818,038	K764E	probably damaging	Het
Abcg2	T	C	6: 58,690,540	V129A	probably benign	Het
Adgrf5	A	G	17: 43,428,586	Y72C	possibly damaging	Het
Ago1	C	T	4: 126,443,228	R228H	probably damaging	Het
Ano1	A	G	7: 144,648,052	V334A	probably damaging	Het
Apob	A	T	12: 8,002,164	R1202*	probably null	Het
Arfgap3	G	T	15: 83,310,300	D389E	probably benign	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Atoh8	T	C	6: 72,235,128	K13E	probably damaging	Het
Bicral	G	T	17: 46,824,888	N465K	possibly damaging	Het
Bves	T	A	10: 45,343,135	Y110N	probably damaging	Het
C4b	A	G	17: 34,728,620	Y1695H	probably damaging	Het
Cage1	A	G	13: 38,023,380	V163A	probably benign	Het
Canx	T	C	11: 50,304,425	N272S	probably damaging	Het
Caskin1	G	T	17: 24,496,459	G93V	probably damaging	Het
Cd34	T	C	1: 194,959,142	V292A	probably damaging	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cdh16	C	A	8: 104,621,965	G144*	probably null	Het
Chaf1b	T	A	16: 93,894,907	H280Q	probably damaging	Het
Chpf2	G	A	5: 24,591,222	G389R	probably damaging	Het
Crb1	T	C	1: 139,314,750	Y330C	probably damaging	Het
Cux2	A	T	5: 121,869,504	V698E	probably benign	Het
Dhtkd1	A	G	2: 5,942,619	V18A	unknown	Het
Dmbt1	G	A	7: 131,106,170	A1381T	possibly damaging	Het
Enpp1	C	G	10: 24,660,192	A437P	probably damaging	Het
Fat2	C	T	11: 55,281,860	V2676I	possibly damaging	Het
Gcm2	T	C	13: 41,109,954	M1V	probably null	Het
Gnai3	C	T	3: 108,112,496	V233I	probably benign	Het
Golim4	T	A	3: 75,894,887	D366V	possibly damaging	Het
Grin1	T	A	2: 25,316,820	T110S	probably damaging	Het
Grin2a	A	G	16: 9,669,744	V430A	probably benign	Het
Gstp3	G	A	19: 4,059,282	T5I	probably damaging	Het
Il17rb	T	A	14: 29,997,154	M324L	probably benign	Het
Jmy	A	G	13: 93,459,703	Y473H	probably damaging	Het
Khdc1b	A	G	1: 21,384,310	D79G	probably benign	Het
Kremen2	T	C	17: 23,742,717	E272G	possibly damaging	Het
Lmo7	G	C	14: 101,887,178	A358P	probably damaging	Het
Mdh1b	T	C	1: 63,721,582	I107V	probably benign	Het
Mlkl	T	C	8: 111,333,610	Q48R	probably benign	Het
Myh2	G	A	11: 67,188,839		probably null	Het
Naip1	T	A	13: 100,425,573	Q1028L	probably damaging	Het
Ncald	T	A	15: 37,397,179	I86F	possibly damaging	Het
Nid1	A	C	13: 13,500,473	H926P	probably benign	Het
Nlrp9a	T	A	7: 26,557,362	I46K	possibly damaging	Het
Olfr59	A	G	11: 74,288,826	Y60C	probably damaging	Het
Olfr823	A	T	10: 130,111,990	S267T	probably benign	Het
Pak1	T	A	7: 97,907,797		probably null	Het
Parpbp	T	A	10: 88,124,962	M221L	probably benign	Het
Pde12	T	C	14: 26,668,880	I225V	probably benign	Het
Phf19	G	T	2: 34,899,608	R367S	probably benign	Het
Plcl2	A	G	17: 50,668,111		probably null	Het
Plxnb1	A	T	9: 109,109,226	I1283F	possibly damaging	Het
Pramel6	T	A	2: 87,508,715	N86K	possibly damaging	Het
Prkdc	A	G	16: 15,727,605	T1862A	probably benign	Het
Prpf40a	A	T	2: 53,144,839	I779K	probably damaging	Het
Ptpn20	A	T	14: 33,630,985	E227V	probably damaging	Het
Rad54b	C	T	4: 11,606,088	R499C	probably benign	Het
Rarg	C	A	15: 102,239,504	A291S	probably damaging	Het
Rnf169	A	T	7: 99,925,408	L660Q	probably damaging	Het
Scn4a	A	G	11: 106,335,724	V670A	probably damaging	Het
Serpinb9c	A	T	13: 33,156,871	C81*	probably null	Het
Sik1	A	G	17: 31,848,797	S435P	probably benign	Het
Slc35g2	G	A	9: 100,553,276	A114V	probably damaging	Het
Slc7a14	A	T	3: 31,237,496	V211E	probably damaging	Het
Snrpn	A	T	7: 59,987,456	H37Q	possibly damaging	Het
Spock3	T	A	8: 63,245,170	C185*	probably null	Het
Tbc1d4	A	G	14: 101,477,155	S627P	probably damaging	Het
Tgoln1	T	C	6: 72,615,670	T276A	probably benign	Het
Tmem176b	G	A	6: 48,836,333	T64I	probably damaging	Het
Tnpo2	T	C	8: 85,050,113	L483P	probably damaging	Het
Tpte	T	A	8: 22,318,339	D163E	probably benign	Het
Trim36	A	T	18: 46,196,162	D70E	probably benign	Het
Umodl1	G	A	17: 31,008,766		probably null	Het
Wdr90	T	C	17: 25,855,199	T691A	probably benign	Het
Zdhhc8	A	G	16: 18,228,346	S118P	probably damaging	Het
Zfp438	T	C	18: 5,214,085	E291G	probably benign	Het
Zfp879	C	T	11: 50,832,601	E543K	probably benign	Het

Other mutations in Fzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01667:Fzd2	APN	11	102605782	missense	possibly damaging	0.94
IGL02034:Fzd2	APN	11	102604904	missense	probably damaging	1.00
IGL02035:Fzd2	APN	11	102606444	makesense	probably null
PIT4585001:Fzd2	UTSW	11	102605747	missense	probably damaging	0.99
R0201:Fzd2	UTSW	11	102606122	missense	probably damaging	1.00
R1146:Fzd2	UTSW	11	102605380	missense	possibly damaging	0.76
R1146:Fzd2	UTSW	11	102605380	missense	possibly damaging	0.76
R1530:Fzd2	UTSW	11	102605308	missense	probably benign	0.00
R1589:Fzd2	UTSW	11	102606328	missense	probably benign	0.06
R1676:Fzd2	UTSW	11	102605881	missense	probably damaging	1.00
R2219:Fzd2	UTSW	11	102605423	missense	probably benign	0.01
R2410:Fzd2	UTSW	11	102605627	missense	possibly damaging	0.71
R5058:Fzd2	UTSW	11	102604807	missense	probably damaging	0.99
R5296:Fzd2	UTSW	11	102606155	missense	probably damaging	0.96
R5580:Fzd2	UTSW	11	102605839	missense	probably damaging	0.99
R5788:Fzd2	UTSW	11	102605467	missense	probably benign	0.03
R6104:Fzd2	UTSW	11	102606335	missense	probably damaging	1.00
R6452:Fzd2	UTSW	11	102604985	missense	probably damaging	1.00
R7454:Fzd2	UTSW	11	102605129	missense	probably damaging	1.00
R7774:Fzd2	UTSW	11	102605488	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ACTTCTTCAGCATGGCCAGC -3'
(R):5'- CTCATAGAAGTAGCAGGCGATG -3'

Sequencing Primer
(F):5'- AGCATGGCCAGCTCCATCTG -3'
(R):5'- TACCGTGTAGAGCACCGAG -3'

Posted On

2014-09-17