Incidental Mutation 'R0153:Kel'
ID22830
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 038436-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0153 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41701943 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 195 (H195Q)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899]
Predicted Effect probably benign
Transcript: ENSMUST00000031899
AA Change: H195Q

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: H195Q

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Meta Mutation Damage Score 0.1299 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik G T 9: 94,524,480 D291E probably benign Het
2010300C02Rik A G 1: 37,624,639 V726A probably benign Het
Abcb9 T C 5: 124,080,056 M406V probably benign Het
Adar T C 3: 89,730,814 S2P probably benign Het
Adgre1 T A 17: 57,443,939 S538T possibly damaging Het
Alms1 T A 6: 85,641,381 I2803N possibly damaging Het
Amn1 G T 6: 149,188,593 probably benign Het
Arid1b G A 17: 5,342,932 A2246T probably damaging Het
BC024139 T C 15: 76,121,747 E418G probably damaging Het
Bok A G 1: 93,686,517 D24G probably damaging Het
Cabp2 T C 19: 4,084,913 probably benign Het
Ccdc141 C A 2: 77,165,238 probably benign Het
Ccdc178 T C 18: 22,150,435 T13A probably benign Het
Ccdc42 G T 11: 68,587,650 V33F possibly damaging Het
Clcn7 G A 17: 25,149,202 probably benign Het
Cluh A G 11: 74,657,350 probably benign Het
Cr1l A T 1: 195,114,856 probably benign Het
Csnk1g3 T A 18: 53,918,789 probably benign Het
Depdc5 T C 5: 32,933,937 probably benign Het
Dgkh A C 14: 78,570,129 Y1149* probably null Het
Dnaic1 A G 4: 41,635,162 probably benign Het
Efcab2 A G 1: 178,474,886 E65G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam71e2 A T 7: 4,770,287 L177Q probably damaging Het
Fgfr4 A G 13: 55,161,385 probably benign Het
Gm10720 A C 9: 3,015,787 S44R probably null Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm6471 A T 7: 142,831,631 noncoding transcript Het
Gm8994 A T 6: 136,328,844 D101V probably damaging Het
Hnrnpm C T 17: 33,646,515 R724Q probably damaging Het
Homer1 C T 13: 93,391,746 T117I possibly damaging Het
Hoxd4 A T 2: 74,727,457 Q60L probably damaging Het
Ift172 T C 5: 31,260,624 R1274G probably benign Het
Ino80d A G 1: 63,058,318 S806P probably damaging Het
Itga10 T C 3: 96,653,700 V627A probably benign Het
Itgb2l A G 16: 96,437,369 Y77H possibly damaging Het
Klhdc7a A G 4: 139,967,271 S122P possibly damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Lats1 T A 10: 7,691,575 S37T probably damaging Het
Lrp1b T A 2: 41,123,019 H1858L possibly damaging Het
Matk A T 10: 81,262,842 T461S probably benign Het
Meikin A G 11: 54,409,642 probably benign Het
Muc6 T C 7: 141,634,116 Q2832R possibly damaging Het
Myo10 T C 15: 25,781,238 F194L possibly damaging Het
Nbas G A 12: 13,273,876 probably benign Het
Nme4 A G 17: 26,093,857 probably null Het
Olfr1136 A G 2: 87,693,604 S93P probably benign Het
Olfr1217 T A 2: 89,023,196 N269I probably benign Het
Olfr1340 A T 4: 118,726,333 I29F possibly damaging Het
Olfr851 T A 9: 19,496,937 L63H probably damaging Het
Olfr954 T C 9: 39,461,671 V80A probably damaging Het
Pacsin2 T C 15: 83,377,661 Q473R probably benign Het
Patz1 A G 11: 3,293,288 H427R probably damaging Het
Pkp3 A G 7: 141,083,343 Y367C probably damaging Het
Prdm2 G A 4: 143,133,768 P984L possibly damaging Het
Rev3l T A 10: 39,874,128 C3091* probably null Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpl5 T C 5: 107,904,757 F140L probably benign Het
Sec24a A C 11: 51,700,826 I1014M probably benign Het
Serpinb11 A G 1: 107,372,203 H93R probably benign Het
Shank2 C A 7: 144,070,135 H286N probably benign Het
Sipa1l2 G T 8: 125,421,898 Q1651K probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc30a5 A T 13: 100,826,494 F75L possibly damaging Het
Slco1a1 G T 6: 141,910,701 probably benign Het
Smg5 C T 3: 88,353,872 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Taf8 A T 17: 47,498,252 probably benign Het
Tarsl2 A G 7: 65,684,081 D617G probably damaging Het
Tbc1d5 A T 17: 50,984,687 probably benign Het
Tfcp2 C G 15: 100,514,827 E315Q probably damaging Het
Tmf1 A T 6: 97,170,384 S540R probably damaging Het
Tmprss4 T C 9: 45,184,336 Q70R probably benign Het
Trip13 G T 13: 73,920,064 A266E possibly damaging Het
Ttc24 T A 3: 88,074,927 probably benign Het
Ttll5 T A 12: 85,831,966 I49N probably damaging Het
Ube2ql1 A T 13: 69,738,592 M250K possibly damaging Het
Vmn1r87 A T 7: 13,132,284 D25E probably damaging Het
Vmn2r84 A G 10: 130,392,008 Y120H probably benign Het
Wdr6 G A 9: 108,575,242 R481C probably damaging Het
Wdr60 A G 12: 116,232,636 V497A probably benign Het
Zcchc6 G A 13: 59,782,336 R962* probably null Het
Zdhhc17 A T 10: 110,955,094 Y371* probably null Het
Zfp292 T C 4: 34,811,185 N620D probably benign Het
Zfp932 T A 5: 110,006,968 Y11N probably benign Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 splice site probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
R7938:Kel UTSW 6 41698376 missense probably benign 0.06
R8028:Kel UTSW 6 41699024 missense probably benign 0.21
R8082:Kel UTSW 6 41703490 missense possibly damaging 0.94
R8465:Kel UTSW 6 41689538 critical splice donor site probably null
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Z1176:Kel UTSW 6 41687572 missense probably damaging 1.00
Z1177:Kel UTSW 6 41689559 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTCACTCTTCAAAGTGCTGGCTC -3'
(R):5'- TGATCTCATGGTCCCAAGGTTCAGG -3'

Sequencing Primer
(F):5'- AAAGTGCTGGCTCTGCTC -3'
(R):5'- TCCCAAGGTTCAGGTTTGTC -3'
Posted On2013-04-16