Incidental Mutation 'R2057:Umodl1'
ID228313
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
MMRRC Submission 040062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2057 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 31008766 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000066981] [ENSMUST00000114555] [ENSMUST00000114555]
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Abcc2 A G 19: 43,818,038 K764E probably damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apob A T 12: 8,002,164 R1202* probably null Het
Arfgap3 G T 15: 83,310,300 D389E probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Atoh8 T C 6: 72,235,128 K13E probably damaging Het
Bicral G T 17: 46,824,888 N465K possibly damaging Het
Bves T A 10: 45,343,135 Y110N probably damaging Het
C4b A G 17: 34,728,620 Y1695H probably damaging Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Caskin1 G T 17: 24,496,459 G93V probably damaging Het
Cd34 T C 1: 194,959,142 V292A probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdh16 C A 8: 104,621,965 G144* probably null Het
Chaf1b T A 16: 93,894,907 H280Q probably damaging Het
Chpf2 G A 5: 24,591,222 G389R probably damaging Het
Crb1 T C 1: 139,314,750 Y330C probably damaging Het
Cux2 A T 5: 121,869,504 V698E probably benign Het
Dhtkd1 A G 2: 5,942,619 V18A unknown Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Enpp1 C G 10: 24,660,192 A437P probably damaging Het
Fat2 C T 11: 55,281,860 V2676I possibly damaging Het
Fzd2 A G 11: 102,605,933 D401G probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gnai3 C T 3: 108,112,496 V233I probably benign Het
Golim4 T A 3: 75,894,887 D366V possibly damaging Het
Grin1 T A 2: 25,316,820 T110S probably damaging Het
Grin2a A G 16: 9,669,744 V430A probably benign Het
Gstp3 G A 19: 4,059,282 T5I probably damaging Het
Il17rb T A 14: 29,997,154 M324L probably benign Het
Jmy A G 13: 93,459,703 Y473H probably damaging Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Lmo7 G C 14: 101,887,178 A358P probably damaging Het
Mdh1b T C 1: 63,721,582 I107V probably benign Het
Mlkl T C 8: 111,333,610 Q48R probably benign Het
Myh2 G A 11: 67,188,839 probably null Het
Naip1 T A 13: 100,425,573 Q1028L probably damaging Het
Ncald T A 15: 37,397,179 I86F possibly damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Olfr59 A G 11: 74,288,826 Y60C probably damaging Het
Olfr823 A T 10: 130,111,990 S267T probably benign Het
Pak1 T A 7: 97,907,797 probably null Het
Parpbp T A 10: 88,124,962 M221L probably benign Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Phf19 G T 2: 34,899,608 R367S probably benign Het
Plcl2 A G 17: 50,668,111 probably null Het
Plxnb1 A T 9: 109,109,226 I1283F possibly damaging Het
Pramel6 T A 2: 87,508,715 N86K possibly damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prpf40a A T 2: 53,144,839 I779K probably damaging Het
Ptpn20 A T 14: 33,630,985 E227V probably damaging Het
Rad54b C T 4: 11,606,088 R499C probably benign Het
Rarg C A 15: 102,239,504 A291S probably damaging Het
Rnf169 A T 7: 99,925,408 L660Q probably damaging Het
Scn4a A G 11: 106,335,724 V670A probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc35g2 G A 9: 100,553,276 A114V probably damaging Het
Slc7a14 A T 3: 31,237,496 V211E probably damaging Het
Snrpn A T 7: 59,987,456 H37Q possibly damaging Het
Spock3 T A 8: 63,245,170 C185* probably null Het
Tbc1d4 A G 14: 101,477,155 S627P probably damaging Het
Tgoln1 T C 6: 72,615,670 T276A probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tnpo2 T C 8: 85,050,113 L483P probably damaging Het
Tpte T A 8: 22,318,339 D163E probably benign Het
Trim36 A T 18: 46,196,162 D70E probably benign Het
Wdr90 T C 17: 25,855,199 T691A probably benign Het
Zdhhc8 A G 16: 18,228,346 S118P probably damaging Het
Zfp438 T C 18: 5,214,085 E291G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
floored UTSW 17 30988057 nonsense probably null
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGACCGGTTACATCATTCTCC -3'
(R):5'- TACCAGGGTCACTGTACCAC -3'

Sequencing Primer
(F):5'- ACATCATTCTCCTAGCGGCAG -3'
(R):5'- CTACCTGAGACCATGGTGTAAATG -3'
Posted On2014-09-17