Mutagenetix > Incidental Mutation

Incidental Mutation 'R2057:C4b'

228317

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

040062-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2057 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34728620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1695 (Y1695H)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

probably damaging
Transcript: ENSMUST00000069507
AA Change: Y1695H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: Y1695H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173669

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	G	A	6: 41,032,381	T173I	probably benign	Het
Abcc2	A	G	19: 43,818,038	K764E	probably damaging	Het
Abcg2	T	C	6: 58,690,540	V129A	probably benign	Het
Adgrf5	A	G	17: 43,428,586	Y72C	possibly damaging	Het
Ago1	C	T	4: 126,443,228	R228H	probably damaging	Het
Ano1	A	G	7: 144,648,052	V334A	probably damaging	Het
Apob	A	T	12: 8,002,164	R1202*	probably null	Het
Arfgap3	G	T	15: 83,310,300	D389E	probably benign	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Atoh8	T	C	6: 72,235,128	K13E	probably damaging	Het
Bicral	G	T	17: 46,824,888	N465K	possibly damaging	Het
Bves	T	A	10: 45,343,135	Y110N	probably damaging	Het
Cage1	A	G	13: 38,023,380	V163A	probably benign	Het
Canx	T	C	11: 50,304,425	N272S	probably damaging	Het
Caskin1	G	T	17: 24,496,459	G93V	probably damaging	Het
Cd34	T	C	1: 194,959,142	V292A	probably damaging	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cdh16	C	A	8: 104,621,965	G144*	probably null	Het
Chaf1b	T	A	16: 93,894,907	H280Q	probably damaging	Het
Chpf2	G	A	5: 24,591,222	G389R	probably damaging	Het
Crb1	T	C	1: 139,314,750	Y330C	probably damaging	Het
Cux2	A	T	5: 121,869,504	V698E	probably benign	Het
Dhtkd1	A	G	2: 5,942,619	V18A	unknown	Het
Dmbt1	G	A	7: 131,106,170	A1381T	possibly damaging	Het
Enpp1	C	G	10: 24,660,192	A437P	probably damaging	Het
Fat2	C	T	11: 55,281,860	V2676I	possibly damaging	Het
Fzd2	A	G	11: 102,605,933	D401G	probably damaging	Het
Gcm2	T	C	13: 41,109,954	M1V	probably null	Het
Gnai3	C	T	3: 108,112,496	V233I	probably benign	Het
Golim4	T	A	3: 75,894,887	D366V	possibly damaging	Het
Grin1	T	A	2: 25,316,820	T110S	probably damaging	Het
Grin2a	A	G	16: 9,669,744	V430A	probably benign	Het
Gstp3	G	A	19: 4,059,282	T5I	probably damaging	Het
Il17rb	T	A	14: 29,997,154	M324L	probably benign	Het
Jmy	A	G	13: 93,459,703	Y473H	probably damaging	Het
Khdc1b	A	G	1: 21,384,310	D79G	probably benign	Het
Kremen2	T	C	17: 23,742,717	E272G	possibly damaging	Het
Lmo7	G	C	14: 101,887,178	A358P	probably damaging	Het
Mdh1b	T	C	1: 63,721,582	I107V	probably benign	Het
Mlkl	T	C	8: 111,333,610	Q48R	probably benign	Het
Myh2	G	A	11: 67,188,839		probably null	Het
Naip1	T	A	13: 100,425,573	Q1028L	probably damaging	Het
Ncald	T	A	15: 37,397,179	I86F	possibly damaging	Het
Nid1	A	C	13: 13,500,473	H926P	probably benign	Het
Nlrp9a	T	A	7: 26,557,362	I46K	possibly damaging	Het
Olfr59	A	G	11: 74,288,826	Y60C	probably damaging	Het
Olfr823	A	T	10: 130,111,990	S267T	probably benign	Het
Pak1	T	A	7: 97,907,797		probably null	Het
Parpbp	T	A	10: 88,124,962	M221L	probably benign	Het
Pde12	T	C	14: 26,668,880	I225V	probably benign	Het
Phf19	G	T	2: 34,899,608	R367S	probably benign	Het
Plcl2	A	G	17: 50,668,111		probably null	Het
Plxnb1	A	T	9: 109,109,226	I1283F	possibly damaging	Het
Pramel6	T	A	2: 87,508,715	N86K	possibly damaging	Het
Prkdc	A	G	16: 15,727,605	T1862A	probably benign	Het
Prpf40a	A	T	2: 53,144,839	I779K	probably damaging	Het
Ptpn20	A	T	14: 33,630,985	E227V	probably damaging	Het
Rad54b	C	T	4: 11,606,088	R499C	probably benign	Het
Rarg	C	A	15: 102,239,504	A291S	probably damaging	Het
Rnf169	A	T	7: 99,925,408	L660Q	probably damaging	Het
Scn4a	A	G	11: 106,335,724	V670A	probably damaging	Het
Serpinb9c	A	T	13: 33,156,871	C81*	probably null	Het
Sik1	A	G	17: 31,848,797	S435P	probably benign	Het
Slc35g2	G	A	9: 100,553,276	A114V	probably damaging	Het
Slc7a14	A	T	3: 31,237,496	V211E	probably damaging	Het
Snrpn	A	T	7: 59,987,456	H37Q	possibly damaging	Het
Spock3	T	A	8: 63,245,170	C185*	probably null	Het
Tbc1d4	A	G	14: 101,477,155	S627P	probably damaging	Het
Tgoln1	T	C	6: 72,615,670	T276A	probably benign	Het
Tmem176b	G	A	6: 48,836,333	T64I	probably damaging	Het
Tnpo2	T	C	8: 85,050,113	L483P	probably damaging	Het
Tpte	T	A	8: 22,318,339	D163E	probably benign	Het
Trim36	A	T	18: 46,196,162	D70E	probably benign	Het
Umodl1	G	A	17: 31,008,766		probably null	Het
Wdr90	T	C	17: 25,855,199	T691A	probably benign	Het
Zdhhc8	A	G	16: 18,228,346	S118P	probably damaging	Het
Zfp438	T	C	18: 5,214,085	E291G	probably benign	Het
Zfp879	C	T	11: 50,832,601	E543K	probably benign	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GAGCAGAGCCTCTAATCCAGTG -3'
(R):5'- CAAAGAGTACTTGATCATGGGGATG -3'

Sequencing Primer
(F):5'- AGCCTCTAATCCAGTGAGGCC -3'
(R):5'- ACTTGATCATGGGGATGGACGG -3'

Posted On

2014-09-17