Incidental Mutation 'R2058:Strc'
ID228338
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
MMRRC Submission 040063-MU
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R2058 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121378887 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 290 (W290R)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
Predicted Effect probably damaging
Transcript: ENSMUST00000038389
AA Change: W290R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: W290R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150332
Meta Mutation Damage Score 0.7484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,672,066 probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Arhgef4 A G 1: 34,722,377 K238R unknown Het
Atf6b A T 17: 34,648,575 probably null Het
Atp2a1 G A 7: 126,447,672 A847V possibly damaging Het
Baz1b T A 5: 135,217,225 N509K probably benign Het
BC051076 A T 5: 87,963,985 noncoding transcript Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Cd302 T A 2: 60,252,423 I186F possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cep112 T A 11: 108,519,261 probably null Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Col4a1 T A 8: 11,210,792 D1330V probably damaging Het
Ctsa T G 2: 164,834,902 M136R probably null Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Gcc2 T A 10: 58,285,957 S1102T probably benign Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gna14 G C 19: 16,608,141 probably benign Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gulo A G 14: 65,991,159 V270A possibly damaging Het
Hps5 T A 7: 46,768,051 D904V probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Jak3 A T 8: 71,685,383 probably null Het
Klhl6 T G 16: 19,982,931 T25P probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Map3k21 A G 8: 125,938,722 K550R probably benign Het
Mphosph10 T A 7: 64,376,751 L650F probably damaging Het
Mrpl48 T C 7: 100,549,333 E204G probably damaging Het
Msh5 A C 17: 35,029,756 V738G probably damaging Het
Mybph G A 1: 134,200,119 C473Y probably damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Notch3 T C 17: 32,143,644 T1336A probably benign Het
Nsun4 T C 4: 116,053,680 probably null Het
Olfr1023 A T 2: 85,886,952 T51S possibly damaging Het
Olfr390 A G 11: 73,787,274 N112S probably benign Het
Osgin1 A G 8: 119,445,673 D402G possibly damaging Het
Patl1 A G 19: 11,932,147 E479G possibly damaging Het
Pbsn T C X: 77,847,976 K72E probably damaging Het
Pcdhb13 A G 18: 37,444,567 Q666R possibly damaging Het
Pi4k2b G A 5: 52,750,680 V131I probably benign Het
Pkn2 G A 3: 142,853,471 H98Y possibly damaging Het
Pms1 A G 1: 53,275,168 Y73H probably benign Het
Ppt2 A T 17: 34,622,844 probably benign Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prl6a1 T C 13: 27,319,098 Y231H probably benign Het
Ranbp3l T A 15: 9,000,817 V41D probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Ripk4 A T 16: 97,744,142 L372* probably null Het
Rnf126 A G 10: 79,759,137 probably benign Het
S100pbp A G 4: 129,182,100 V144A probably benign Het
Saal1 T C 7: 46,699,456 Q317R probably damaging Het
Sap25 G A 5: 137,642,772 G277R probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Set A G 2: 30,069,036 K70E possibly damaging Het
Setd3 A G 12: 108,107,341 I559T probably benign Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Skint3 A T 4: 112,255,783 K197* probably null Het
Skint5 T A 4: 113,870,700 I402F possibly damaging Het
Slc18a1 G A 8: 69,043,961 T350M probably damaging Het
Slc19a3 A T 1: 83,014,791 I403K probably damaging Het
Slc1a7 C T 4: 108,004,439 T225I probably benign Het
Slc38a4 T C 15: 97,008,725 I336V probably benign Het
Smarcc1 A G 9: 110,118,343 probably benign Het
St8sia5 A T 18: 77,254,763 I390F probably damaging Het
Svep1 T C 4: 58,084,554 D1858G possibly damaging Het
Sympk G A 7: 19,043,529 R568Q probably damaging Het
Tex44 A C 1: 86,427,006 K212N probably damaging Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thrap3 C T 4: 126,180,174 V260I probably damaging Het
Thsd7a A T 6: 12,318,106 probably benign Het
Trim12c A G 7: 104,348,191 F53L possibly damaging Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ubap2l A T 3: 90,031,376 probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Usp17la A C 7: 104,861,171 T328P probably damaging Het
Vmn2r113 T A 17: 22,958,249 L669* probably null Het
Vps13b T A 15: 35,841,447 V2541E probably damaging Het
Wnt3 T C 11: 103,812,285 I198T probably damaging Het
Zfp316 T C 5: 143,263,406 E158G unknown Het
Zfp362 T G 4: 128,786,987 I182L possibly damaging Het
Zfp804a A G 2: 82,257,366 D513G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Zfp97 T A 17: 17,144,756 N172K possibly damaging Het
Zmym6 A T 4: 127,088,415 K82* probably null Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 unclassified probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAACGTTGTTCTAAGCGG -3'
(R):5'- GCGAGTCACTCATTCTCTGC -3'

Sequencing Primer
(F):5'- TGAAACTTGCGCTGTAGACC -3'
(R):5'- GTCACTCATTCTCTGCAAGATGAGG -3'
Posted On2014-09-17