Incidental Mutation 'R2058:Tgm4'
ID 228383
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Name transglutaminase 4 (prostate)
Synonyms Eapa1, 9530008N10Rik, experimental autoimmune prostatitis antigen 1
MMRRC Submission 040063-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R2058 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 122863806-122896623 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122890835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 54 (I54T)
Ref Sequence ENSEMBL: ENSMUSP00000149120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000140497] [ENSMUST00000215247] [ENSMUST00000217607]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000026893
AA Change: I478T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: I478T

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140497
SMART Domains Protein: ENSMUSP00000122604
Gene: ENSMUSG00000025786

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214552
Predicted Effect probably damaging
Transcript: ENSMUST00000215247
AA Change: I54T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000217607
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 99% (94/95)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 25,162,082 (GRCm39) probably benign Het
Adgrf5 A G 17: 43,739,477 (GRCm39) Y72C possibly damaging Het
Alas1 T C 9: 106,118,489 (GRCm39) E211G probably damaging Het
Alkbh1 C T 12: 87,490,520 (GRCm39) probably benign Het
Ano1 A G 7: 144,201,789 (GRCm39) V334A probably damaging Het
Arhgap18 C T 10: 26,730,904 (GRCm39) T122I probably benign Het
Arhgef4 A G 1: 34,761,458 (GRCm39) K238R unknown Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Atp2a1 G A 7: 126,046,844 (GRCm39) A847V possibly damaging Het
Baz1b T A 5: 135,246,079 (GRCm39) N509K probably benign Het
BC051076 A T 5: 88,111,844 (GRCm39) noncoding transcript Het
Cage1 A G 13: 38,207,356 (GRCm39) V163A probably benign Het
Canx T C 11: 50,195,252 (GRCm39) N272S probably damaging Het
Cd302 T A 2: 60,082,767 (GRCm39) I186F possibly damaging Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Cep112 T A 11: 108,410,087 (GRCm39) probably null Het
Cmtm4 A C 8: 105,081,920 (GRCm39) F156V probably damaging Het
Col4a1 T A 8: 11,260,792 (GRCm39) D1330V probably damaging Het
Ctsa T G 2: 164,676,822 (GRCm39) M136R probably null Het
Cyp2d10 T A 15: 82,288,015 (GRCm39) I363F probably damaging Het
Dmbt1 G A 7: 130,707,900 (GRCm39) A1381T possibly damaging Het
Dmwd T A 7: 18,814,652 (GRCm39) L434Q probably damaging Het
Fat4 T A 3: 38,945,319 (GRCm39) M1404K possibly damaging Het
Gcc2 T A 10: 58,121,779 (GRCm39) S1102T probably benign Het
Gcm2 T C 13: 41,263,430 (GRCm39) M1V probably null Het
Gna14 G C 19: 16,585,505 (GRCm39) probably benign Het
Gsk3b T A 16: 38,008,271 (GRCm39) D192E probably benign Het
Gulo A G 14: 66,228,608 (GRCm39) V270A possibly damaging Het
Hps5 T A 7: 46,417,475 (GRCm39) D904V probably damaging Het
Il7 A T 3: 7,638,975 (GRCm39) N130K probably damaging Het
Jak3 A T 8: 72,138,027 (GRCm39) probably null Het
Klhl6 T G 16: 19,801,681 (GRCm39) T25P probably benign Het
Kremen2 T C 17: 23,961,691 (GRCm39) E272G possibly damaging Het
Map3k21 A G 8: 126,665,461 (GRCm39) K550R probably benign Het
Mphosph10 T A 7: 64,026,499 (GRCm39) L650F probably damaging Het
Mrpl48 T C 7: 100,198,540 (GRCm39) E204G probably damaging Het
Msh5 A C 17: 35,248,732 (GRCm39) V738G probably damaging Het
Mybph G A 1: 134,127,857 (GRCm39) C473Y probably damaging Het
Nid1 A C 13: 13,675,058 (GRCm39) H926P probably benign Het
Nlrp9a T A 7: 26,256,787 (GRCm39) I46K possibly damaging Het
Notch3 T C 17: 32,362,618 (GRCm39) T1336A probably benign Het
Nsun4 T C 4: 115,910,877 (GRCm39) probably null Het
Or1e30 A G 11: 73,678,100 (GRCm39) N112S probably benign Het
Or5m10 A T 2: 85,717,296 (GRCm39) T51S possibly damaging Het
Osgin1 A G 8: 120,172,412 (GRCm39) D402G possibly damaging Het
Patl1 A G 19: 11,909,511 (GRCm39) E479G possibly damaging Het
Pbsn T C X: 76,891,582 (GRCm39) K72E probably damaging Het
Pcdhb13 A G 18: 37,577,620 (GRCm39) Q666R possibly damaging Het
Pi4k2b G A 5: 52,908,022 (GRCm39) V131I probably benign Het
Pkn2 G A 3: 142,559,232 (GRCm39) H98Y possibly damaging Het
Pms1 A G 1: 53,314,327 (GRCm39) Y73H probably benign Het
Ppt2 A T 17: 34,841,818 (GRCm39) probably benign Het
Prkdc A G 16: 15,545,469 (GRCm39) T1862A probably benign Het
Prl6a1 T C 13: 27,503,081 (GRCm39) Y231H probably benign Het
Ranbp3l T A 15: 9,029,641 (GRCm39) V41D probably damaging Het
Rhobtb2 T C 14: 70,031,488 (GRCm39) T546A possibly damaging Het
Ripk4 A T 16: 97,545,342 (GRCm39) L372* probably null Het
Rnf126 A G 10: 79,594,971 (GRCm39) probably benign Het
S100pbp A G 4: 129,075,893 (GRCm39) V144A probably benign Het
Saal1 T C 7: 46,348,880 (GRCm39) Q317R probably damaging Het
Sap25 G A 5: 137,641,034 (GRCm39) G277R probably damaging Het
Senp2 C T 16: 21,832,949 (GRCm39) T79I probably damaging Het
Serpinb9c A T 13: 33,340,854 (GRCm39) C81* probably null Het
Set A G 2: 29,959,048 (GRCm39) K70E possibly damaging Het
Setd3 A G 12: 108,073,600 (GRCm39) I559T probably benign Het
Sik1 A G 17: 32,067,771 (GRCm39) S435P probably benign Het
Skint3 A T 4: 112,112,980 (GRCm39) K197* probably null Het
Skint5 T A 4: 113,727,897 (GRCm39) I402F possibly damaging Het
Slc18a1 G A 8: 69,496,613 (GRCm39) T350M probably damaging Het
Slc19a3 A T 1: 82,992,512 (GRCm39) I403K probably damaging Het
Slc1a7 C T 4: 107,861,636 (GRCm39) T225I probably benign Het
Slc38a4 T C 15: 96,906,606 (GRCm39) I336V probably benign Het
Smarcc1 A G 9: 109,947,411 (GRCm39) probably benign Het
St8sia5 A T 18: 77,342,459 (GRCm39) I390F probably damaging Het
Strc A T 2: 121,209,368 (GRCm39) W290R probably damaging Het
Svep1 T C 4: 58,084,554 (GRCm39) D1858G possibly damaging Het
Sympk G A 7: 18,777,454 (GRCm39) R568Q probably damaging Het
Tex44 A C 1: 86,354,728 (GRCm39) K212N probably damaging Het
Thrap3 C T 4: 126,073,967 (GRCm39) V260I probably damaging Het
Thsd7a A T 6: 12,318,105 (GRCm39) probably benign Het
Trim12c A G 7: 103,997,398 (GRCm39) F53L possibly damaging Het
Ttc6 T A 12: 57,784,479 (GRCm39) D1849E probably benign Het
Ubap2l A T 3: 89,938,683 (GRCm39) probably benign Het
Umodl1 G A 17: 31,227,740 (GRCm39) probably null Het
Usp17la A C 7: 104,510,378 (GRCm39) T328P probably damaging Het
Vmn2r113 T A 17: 23,177,223 (GRCm39) L669* probably null Het
Vps13b T A 15: 35,841,593 (GRCm39) V2541E probably damaging Het
Wnt3 T C 11: 103,703,111 (GRCm39) I198T probably damaging Het
Zfp316 T C 5: 143,249,161 (GRCm39) E158G unknown Het
Zfp362 T G 4: 128,680,780 (GRCm39) I182L possibly damaging Het
Zfp804a A G 2: 82,087,710 (GRCm39) D513G probably benign Het
Zfp879 C T 11: 50,723,428 (GRCm39) E543K probably benign Het
Zfp97 T A 17: 17,365,018 (GRCm39) N172K possibly damaging Het
Zmym6 A T 4: 126,982,208 (GRCm39) K82* probably null Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 122,891,447 (GRCm39) unclassified probably benign
IGL01402:Tgm4 APN 9 122,880,519 (GRCm39) missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 122,885,531 (GRCm39) missense probably damaging 1.00
IGL02120:Tgm4 APN 9 122,875,594 (GRCm39) missense probably damaging 0.98
IGL03130:Tgm4 APN 9 122,885,580 (GRCm39) missense probably damaging 1.00
IGL03188:Tgm4 APN 9 122,874,101 (GRCm39) missense probably null 0.06
R0329:Tgm4 UTSW 9 122,877,622 (GRCm39) critical splice donor site probably null
R0480:Tgm4 UTSW 9 122,891,484 (GRCm39) missense probably benign
R0644:Tgm4 UTSW 9 122,880,523 (GRCm39) missense probably damaging 1.00
R0990:Tgm4 UTSW 9 122,875,576 (GRCm39) missense probably benign 0.02
R1604:Tgm4 UTSW 9 122,874,129 (GRCm39) missense probably benign 0.39
R1644:Tgm4 UTSW 9 122,880,481 (GRCm39) missense probably damaging 1.00
R2056:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2059:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2076:Tgm4 UTSW 9 122,880,160 (GRCm39) missense probably benign 0.24
R2437:Tgm4 UTSW 9 122,877,614 (GRCm39) nonsense probably null
R4392:Tgm4 UTSW 9 122,895,817 (GRCm39) missense probably benign 0.10
R4407:Tgm4 UTSW 9 122,885,595 (GRCm39) missense probably damaging 1.00
R4752:Tgm4 UTSW 9 122,880,451 (GRCm39) missense probably damaging 1.00
R5288:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5365:Tgm4 UTSW 9 122,895,866 (GRCm39) missense probably damaging 1.00
R5386:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5790:Tgm4 UTSW 9 122,890,808 (GRCm39) missense probably damaging 0.98
R5890:Tgm4 UTSW 9 122,890,703 (GRCm39) missense probably damaging 1.00
R6102:Tgm4 UTSW 9 122,885,600 (GRCm39) missense probably benign
R6358:Tgm4 UTSW 9 122,885,583 (GRCm39) missense probably damaging 1.00
R6956:Tgm4 UTSW 9 122,893,768 (GRCm39) missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 122,880,207 (GRCm39) missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 122,869,525 (GRCm39) missense probably damaging 1.00
R7258:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7313:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7369:Tgm4 UTSW 9 122,885,749 (GRCm39) critical splice donor site probably null
R7802:Tgm4 UTSW 9 122,880,401 (GRCm39) intron probably benign
R8219:Tgm4 UTSW 9 122,874,117 (GRCm39) missense probably benign
R8787:Tgm4 UTSW 9 122,890,910 (GRCm39) missense probably damaging 1.00
R8936:Tgm4 UTSW 9 122,869,541 (GRCm39) missense possibly damaging 0.92
R9045:Tgm4 UTSW 9 122,877,616 (GRCm39) missense possibly damaging 0.94
R9328:Tgm4 UTSW 9 122,885,697 (GRCm39) missense possibly damaging 0.93
R9359:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9403:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9471:Tgm4 UTSW 9 122,869,444 (GRCm39) missense probably benign
R9746:Tgm4 UTSW 9 122,875,634 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AATGGGAAGGTTCTCTCAGCC -3'
(R):5'- GTGCCTGGATTCCTTGTCAC -3'

Sequencing Primer
(F):5'- CCCAAGGGTGTCTTCAGAAAATATTC -3'
(R):5'- TGGATTCCTTGTCACCACCAAAATG -3'
Posted On 2014-09-17