Incidental Mutation 'R0153:Sipa1l2'
ID22840
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 038436-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R0153 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 125421898 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1651 (Q1651K)
Ref Sequence ENSEMBL: ENSMUSP00000148557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably damaging
Transcript: ENSMUST00000108775
AA Change: Q1669K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: Q1669K

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212168
AA Change: Q1651K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212987
AA Change: Q1669K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik G T 9: 94,524,480 D291E probably benign Het
2010300C02Rik A G 1: 37,624,639 V726A probably benign Het
Abcb9 T C 5: 124,080,056 M406V probably benign Het
Adar T C 3: 89,730,814 S2P probably benign Het
Adgre1 T A 17: 57,443,939 S538T possibly damaging Het
Alms1 T A 6: 85,641,381 I2803N possibly damaging Het
Amn1 G T 6: 149,188,593 probably benign Het
Arid1b G A 17: 5,342,932 A2246T probably damaging Het
BC024139 T C 15: 76,121,747 E418G probably damaging Het
Bok A G 1: 93,686,517 D24G probably damaging Het
Cabp2 T C 19: 4,084,913 probably benign Het
Ccdc141 C A 2: 77,165,238 probably benign Het
Ccdc178 T C 18: 22,150,435 T13A probably benign Het
Ccdc42 G T 11: 68,587,650 V33F possibly damaging Het
Clcn7 G A 17: 25,149,202 probably benign Het
Cluh A G 11: 74,657,350 probably benign Het
Cr1l A T 1: 195,114,856 probably benign Het
Csnk1g3 T A 18: 53,918,789 probably benign Het
Depdc5 T C 5: 32,933,937 probably benign Het
Dgkh A C 14: 78,570,129 Y1149* probably null Het
Dnaic1 A G 4: 41,635,162 probably benign Het
Efcab2 A G 1: 178,474,886 E65G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam71e2 A T 7: 4,770,287 L177Q probably damaging Het
Fgfr4 A G 13: 55,161,385 probably benign Het
Gm10720 A C 9: 3,015,787 S44R probably null Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm6471 A T 7: 142,831,631 noncoding transcript Het
Gm8994 A T 6: 136,328,844 D101V probably damaging Het
Hnrnpm C T 17: 33,646,515 R724Q probably damaging Het
Homer1 C T 13: 93,391,746 T117I possibly damaging Het
Hoxd4 A T 2: 74,727,457 Q60L probably damaging Het
Ift172 T C 5: 31,260,624 R1274G probably benign Het
Ino80d A G 1: 63,058,318 S806P probably damaging Het
Itga10 T C 3: 96,653,700 V627A probably benign Het
Itgb2l A G 16: 96,437,369 Y77H possibly damaging Het
Kel A T 6: 41,701,943 H195Q probably benign Het
Klhdc7a A G 4: 139,967,271 S122P possibly damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Lats1 T A 10: 7,691,575 S37T probably damaging Het
Lrp1b T A 2: 41,123,019 H1858L possibly damaging Het
Matk A T 10: 81,262,842 T461S probably benign Het
Meikin A G 11: 54,409,642 probably benign Het
Muc6 T C 7: 141,634,116 Q2832R possibly damaging Het
Myo10 T C 15: 25,781,238 F194L possibly damaging Het
Nbas G A 12: 13,273,876 probably benign Het
Nme4 A G 17: 26,093,857 probably null Het
Olfr1136 A G 2: 87,693,604 S93P probably benign Het
Olfr1217 T A 2: 89,023,196 N269I probably benign Het
Olfr1340 A T 4: 118,726,333 I29F possibly damaging Het
Olfr851 T A 9: 19,496,937 L63H probably damaging Het
Olfr954 T C 9: 39,461,671 V80A probably damaging Het
Pacsin2 T C 15: 83,377,661 Q473R probably benign Het
Patz1 A G 11: 3,293,288 H427R probably damaging Het
Pkp3 A G 7: 141,083,343 Y367C probably damaging Het
Prdm2 G A 4: 143,133,768 P984L possibly damaging Het
Rev3l T A 10: 39,874,128 C3091* probably null Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpl5 T C 5: 107,904,757 F140L probably benign Het
Sec24a A C 11: 51,700,826 I1014M probably benign Het
Serpinb11 A G 1: 107,372,203 H93R probably benign Het
Shank2 C A 7: 144,070,135 H286N probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc30a5 A T 13: 100,826,494 F75L possibly damaging Het
Slco1a1 G T 6: 141,910,701 probably benign Het
Smg5 C T 3: 88,353,872 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Taf8 A T 17: 47,498,252 probably benign Het
Tarsl2 A G 7: 65,684,081 D617G probably damaging Het
Tbc1d5 A T 17: 50,984,687 probably benign Het
Tfcp2 C G 15: 100,514,827 E315Q probably damaging Het
Tmf1 A T 6: 97,170,384 S540R probably damaging Het
Tmprss4 T C 9: 45,184,336 Q70R probably benign Het
Trip13 G T 13: 73,920,064 A266E possibly damaging Het
Ttc24 T A 3: 88,074,927 probably benign Het
Ttll5 T A 12: 85,831,966 I49N probably damaging Het
Ube2ql1 A T 13: 69,738,592 M250K possibly damaging Het
Vmn1r87 A T 7: 13,132,284 D25E probably damaging Het
Vmn2r84 A G 10: 130,392,008 Y120H probably benign Het
Wdr6 G A 9: 108,575,242 R481C probably damaging Het
Wdr60 A G 12: 116,232,636 V497A probably benign Het
Zcchc6 G A 13: 59,782,336 R962* probably null Het
Zdhhc17 A T 10: 110,955,094 Y371* probably null Het
Zfp292 T C 4: 34,811,185 N620D probably benign Het
Zfp932 T A 5: 110,006,968 Y11N probably benign Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGACTGTGAGAGCTGACTGACTGAC -3'
(R):5'- AACTTGCTGGGGAACCTGGTTCTG -3'

Sequencing Primer
(F):5'- ctgactgactgactgactgac -3'
(R):5'- GGTTCTGTCTTCAGGACAAAAGC -3'
Posted On2013-04-16