Incidental Mutation 'R2058:Umodl1'
ID 228416
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission 040063-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2058 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 31173614-31229684 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 31227740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000066981] [ENSMUST00000114555] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 99% (94/95)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 25,162,082 (GRCm39) probably benign Het
Adgrf5 A G 17: 43,739,477 (GRCm39) Y72C possibly damaging Het
Alas1 T C 9: 106,118,489 (GRCm39) E211G probably damaging Het
Alkbh1 C T 12: 87,490,520 (GRCm39) probably benign Het
Ano1 A G 7: 144,201,789 (GRCm39) V334A probably damaging Het
Arhgap18 C T 10: 26,730,904 (GRCm39) T122I probably benign Het
Arhgef4 A G 1: 34,761,458 (GRCm39) K238R unknown Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Atp2a1 G A 7: 126,046,844 (GRCm39) A847V possibly damaging Het
Baz1b T A 5: 135,246,079 (GRCm39) N509K probably benign Het
BC051076 A T 5: 88,111,844 (GRCm39) noncoding transcript Het
Cage1 A G 13: 38,207,356 (GRCm39) V163A probably benign Het
Canx T C 11: 50,195,252 (GRCm39) N272S probably damaging Het
Cd302 T A 2: 60,082,767 (GRCm39) I186F possibly damaging Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Cep112 T A 11: 108,410,087 (GRCm39) probably null Het
Cmtm4 A C 8: 105,081,920 (GRCm39) F156V probably damaging Het
Col4a1 T A 8: 11,260,792 (GRCm39) D1330V probably damaging Het
Ctsa T G 2: 164,676,822 (GRCm39) M136R probably null Het
Cyp2d10 T A 15: 82,288,015 (GRCm39) I363F probably damaging Het
Dmbt1 G A 7: 130,707,900 (GRCm39) A1381T possibly damaging Het
Dmwd T A 7: 18,814,652 (GRCm39) L434Q probably damaging Het
Fat4 T A 3: 38,945,319 (GRCm39) M1404K possibly damaging Het
Gcc2 T A 10: 58,121,779 (GRCm39) S1102T probably benign Het
Gcm2 T C 13: 41,263,430 (GRCm39) M1V probably null Het
Gna14 G C 19: 16,585,505 (GRCm39) probably benign Het
Gsk3b T A 16: 38,008,271 (GRCm39) D192E probably benign Het
Gulo A G 14: 66,228,608 (GRCm39) V270A possibly damaging Het
Hps5 T A 7: 46,417,475 (GRCm39) D904V probably damaging Het
Il7 A T 3: 7,638,975 (GRCm39) N130K probably damaging Het
Jak3 A T 8: 72,138,027 (GRCm39) probably null Het
Klhl6 T G 16: 19,801,681 (GRCm39) T25P probably benign Het
Kremen2 T C 17: 23,961,691 (GRCm39) E272G possibly damaging Het
Map3k21 A G 8: 126,665,461 (GRCm39) K550R probably benign Het
Mphosph10 T A 7: 64,026,499 (GRCm39) L650F probably damaging Het
Mrpl48 T C 7: 100,198,540 (GRCm39) E204G probably damaging Het
Msh5 A C 17: 35,248,732 (GRCm39) V738G probably damaging Het
Mybph G A 1: 134,127,857 (GRCm39) C473Y probably damaging Het
Nid1 A C 13: 13,675,058 (GRCm39) H926P probably benign Het
Nlrp9a T A 7: 26,256,787 (GRCm39) I46K possibly damaging Het
Notch3 T C 17: 32,362,618 (GRCm39) T1336A probably benign Het
Nsun4 T C 4: 115,910,877 (GRCm39) probably null Het
Or1e30 A G 11: 73,678,100 (GRCm39) N112S probably benign Het
Or5m10 A T 2: 85,717,296 (GRCm39) T51S possibly damaging Het
Osgin1 A G 8: 120,172,412 (GRCm39) D402G possibly damaging Het
Patl1 A G 19: 11,909,511 (GRCm39) E479G possibly damaging Het
Pbsn T C X: 76,891,582 (GRCm39) K72E probably damaging Het
Pcdhb13 A G 18: 37,577,620 (GRCm39) Q666R possibly damaging Het
Pi4k2b G A 5: 52,908,022 (GRCm39) V131I probably benign Het
Pkn2 G A 3: 142,559,232 (GRCm39) H98Y possibly damaging Het
Pms1 A G 1: 53,314,327 (GRCm39) Y73H probably benign Het
Ppt2 A T 17: 34,841,818 (GRCm39) probably benign Het
Prkdc A G 16: 15,545,469 (GRCm39) T1862A probably benign Het
Prl6a1 T C 13: 27,503,081 (GRCm39) Y231H probably benign Het
Ranbp3l T A 15: 9,029,641 (GRCm39) V41D probably damaging Het
Rhobtb2 T C 14: 70,031,488 (GRCm39) T546A possibly damaging Het
Ripk4 A T 16: 97,545,342 (GRCm39) L372* probably null Het
Rnf126 A G 10: 79,594,971 (GRCm39) probably benign Het
S100pbp A G 4: 129,075,893 (GRCm39) V144A probably benign Het
Saal1 T C 7: 46,348,880 (GRCm39) Q317R probably damaging Het
Sap25 G A 5: 137,641,034 (GRCm39) G277R probably damaging Het
Senp2 C T 16: 21,832,949 (GRCm39) T79I probably damaging Het
Serpinb9c A T 13: 33,340,854 (GRCm39) C81* probably null Het
Set A G 2: 29,959,048 (GRCm39) K70E possibly damaging Het
Setd3 A G 12: 108,073,600 (GRCm39) I559T probably benign Het
Sik1 A G 17: 32,067,771 (GRCm39) S435P probably benign Het
Skint3 A T 4: 112,112,980 (GRCm39) K197* probably null Het
Skint5 T A 4: 113,727,897 (GRCm39) I402F possibly damaging Het
Slc18a1 G A 8: 69,496,613 (GRCm39) T350M probably damaging Het
Slc19a3 A T 1: 82,992,512 (GRCm39) I403K probably damaging Het
Slc1a7 C T 4: 107,861,636 (GRCm39) T225I probably benign Het
Slc38a4 T C 15: 96,906,606 (GRCm39) I336V probably benign Het
Smarcc1 A G 9: 109,947,411 (GRCm39) probably benign Het
St8sia5 A T 18: 77,342,459 (GRCm39) I390F probably damaging Het
Strc A T 2: 121,209,368 (GRCm39) W290R probably damaging Het
Svep1 T C 4: 58,084,554 (GRCm39) D1858G possibly damaging Het
Sympk G A 7: 18,777,454 (GRCm39) R568Q probably damaging Het
Tex44 A C 1: 86,354,728 (GRCm39) K212N probably damaging Het
Tgm4 T C 9: 122,890,835 (GRCm39) I54T probably damaging Het
Thrap3 C T 4: 126,073,967 (GRCm39) V260I probably damaging Het
Thsd7a A T 6: 12,318,105 (GRCm39) probably benign Het
Trim12c A G 7: 103,997,398 (GRCm39) F53L possibly damaging Het
Ttc6 T A 12: 57,784,479 (GRCm39) D1849E probably benign Het
Ubap2l A T 3: 89,938,683 (GRCm39) probably benign Het
Usp17la A C 7: 104,510,378 (GRCm39) T328P probably damaging Het
Vmn2r113 T A 17: 23,177,223 (GRCm39) L669* probably null Het
Vps13b T A 15: 35,841,593 (GRCm39) V2541E probably damaging Het
Wnt3 T C 11: 103,703,111 (GRCm39) I198T probably damaging Het
Zfp316 T C 5: 143,249,161 (GRCm39) E158G unknown Het
Zfp362 T G 4: 128,680,780 (GRCm39) I182L possibly damaging Het
Zfp804a A G 2: 82,087,710 (GRCm39) D513G probably benign Het
Zfp879 C T 11: 50,723,428 (GRCm39) E543K probably benign Het
Zfp97 T A 17: 17,365,018 (GRCm39) N172K possibly damaging Het
Zmym6 A T 4: 126,982,208 (GRCm39) K82* probably null Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31,227,724 (GRCm39) utr 3 prime probably benign
IGL01344:Umodl1 APN 17 31,215,238 (GRCm39) missense probably damaging 0.99
IGL01529:Umodl1 APN 17 31,215,233 (GRCm39) missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 31,217,800 (GRCm39) missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 31,215,229 (GRCm39) missense probably benign 0.00
IGL01877:Umodl1 APN 17 31,201,294 (GRCm39) missense probably benign 0.00
IGL01977:Umodl1 APN 17 31,192,742 (GRCm39) missense probably damaging 0.99
IGL02063:Umodl1 APN 17 31,206,888 (GRCm39) missense probably benign 0.07
IGL02160:Umodl1 APN 17 31,205,091 (GRCm39) missense probably damaging 0.97
IGL02252:Umodl1 APN 17 31,213,789 (GRCm39) critical splice donor site probably null
IGL02427:Umodl1 APN 17 31,187,415 (GRCm39) splice site probably benign
IGL02496:Umodl1 APN 17 31,217,628 (GRCm39) missense probably damaging 0.99
IGL02633:Umodl1 APN 17 31,208,462 (GRCm39) missense probably damaging 1.00
IGL03271:Umodl1 APN 17 31,205,473 (GRCm39) nonsense probably null
IGL03392:Umodl1 APN 17 31,215,329 (GRCm39) missense probably damaging 0.98
Disquieting UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
floored UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7231_umodl1_507 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
surprising UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
unsettling UTSW 17 31,205,528 (GRCm39) nonsense probably null
G1citation:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
PIT4468001:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0653:Umodl1 UTSW 17 31,203,002 (GRCm39) missense probably benign 0.00
R0831:Umodl1 UTSW 17 31,215,325 (GRCm39) missense probably damaging 1.00
R1078:Umodl1 UTSW 17 31,178,347 (GRCm39) missense probably benign 0.00
R1166:Umodl1 UTSW 17 31,221,772 (GRCm39) splice site probably benign
R1231:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R1459:Umodl1 UTSW 17 31,205,478 (GRCm39) missense probably benign 0.05
R1459:Umodl1 UTSW 17 31,201,232 (GRCm39) splice site probably benign
R1510:Umodl1 UTSW 17 31,178,203 (GRCm39) missense probably damaging 1.00
R1654:Umodl1 UTSW 17 31,206,942 (GRCm39) missense probably benign
R1757:Umodl1 UTSW 17 31,227,674 (GRCm39) missense probably damaging 0.99
R1781:Umodl1 UTSW 17 31,187,524 (GRCm39) missense probably damaging 1.00
R1873:Umodl1 UTSW 17 31,201,238 (GRCm39) missense probably damaging 0.99
R1911:Umodl1 UTSW 17 31,211,128 (GRCm39) missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R1918:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2089:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2431:Umodl1 UTSW 17 31,211,062 (GRCm39) missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 31,211,147 (GRCm39) missense probably damaging 1.00
R3032:Umodl1 UTSW 17 31,208,502 (GRCm39) missense probably benign 0.01
R3956:Umodl1 UTSW 17 31,221,837 (GRCm39) missense probably benign 0.10
R3975:Umodl1 UTSW 17 31,203,763 (GRCm39) nonsense probably null
R4207:Umodl1 UTSW 17 31,178,341 (GRCm39) missense probably damaging 1.00
R4287:Umodl1 UTSW 17 31,207,039 (GRCm39) missense probably benign 0.11
R4452:Umodl1 UTSW 17 31,213,789 (GRCm39) critical splice donor site probably null
R4684:Umodl1 UTSW 17 31,217,088 (GRCm39) missense probably benign 0.00
R4769:Umodl1 UTSW 17 31,202,976 (GRCm39) missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R4888:Umodl1 UTSW 17 31,218,175 (GRCm39) missense probably damaging 1.00
R4978:Umodl1 UTSW 17 31,205,055 (GRCm39) missense probably benign
R4993:Umodl1 UTSW 17 31,205,459 (GRCm39) missense probably benign 0.00
R5241:Umodl1 UTSW 17 31,203,066 (GRCm39) missense probably benign 0.18
R5254:Umodl1 UTSW 17 31,199,333 (GRCm39) missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 31,201,263 (GRCm39) missense probably benign 0.04
R5754:Umodl1 UTSW 17 31,213,761 (GRCm39) missense probably damaging 0.96
R6189:Umodl1 UTSW 17 31,215,256 (GRCm39) missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31,221,866 (GRCm39) critical splice donor site probably null
R6289:Umodl1 UTSW 17 31,201,325 (GRCm39) missense probably benign 0.16
R6432:Umodl1 UTSW 17 31,205,121 (GRCm39) missense probably benign 0.38
R6478:Umodl1 UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
R6702:Umodl1 UTSW 17 31,205,273 (GRCm39) splice site probably null
R6822:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
R6999:Umodl1 UTSW 17 31,218,097 (GRCm39) missense probably damaging 1.00
R7067:Umodl1 UTSW 17 31,201,246 (GRCm39) missense probably damaging 1.00
R7123:Umodl1 UTSW 17 31,201,318 (GRCm39) missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 31,201,236 (GRCm39) critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
R7234:Umodl1 UTSW 17 31,205,595 (GRCm39) missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R7392:Umodl1 UTSW 17 31,201,306 (GRCm39) missense probably damaging 0.99
R7401:Umodl1 UTSW 17 31,217,122 (GRCm39) missense probably damaging 1.00
R7461:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7594:Umodl1 UTSW 17 31,173,779 (GRCm39) missense probably benign 0.02
R7613:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7763:Umodl1 UTSW 17 31,205,430 (GRCm39) missense probably benign 0.24
R7797:Umodl1 UTSW 17 31,178,125 (GRCm39) missense probably benign 0.02
R7832:Umodl1 UTSW 17 31,192,666 (GRCm39) critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 31,205,361 (GRCm39) missense probably benign 0.00
R8088:Umodl1 UTSW 17 31,192,770 (GRCm39) missense probably benign 0.29
R8111:Umodl1 UTSW 17 31,190,792 (GRCm39) missense probably damaging 0.99
R8314:Umodl1 UTSW 17 31,203,806 (GRCm39) missense probably damaging 0.99
R8826:Umodl1 UTSW 17 31,202,958 (GRCm39) missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 31,192,677 (GRCm39) missense probably damaging 1.00
R9091:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9099:Umodl1 UTSW 17 31,178,147 (GRCm39) missense probably benign 0.01
R9270:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9341:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 31,215,367 (GRCm39) missense probably damaging 0.99
R9569:Umodl1 UTSW 17 31,217,143 (GRCm39) missense probably damaging 1.00
R9615:Umodl1 UTSW 17 31,217,152 (GRCm39) missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 31,178,324 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTACCTATCTCACCCACAG -3'
(R):5'- GCAGAACTCTTTGCTGACCTAC -3'

Sequencing Primer
(F):5'- GGCATGTACAAAGCCAGTCCTG -3'
(R):5'- GCTGACCTACAAATGGTCCCTG -3'
Posted On 2014-09-17