Incidental Mutation 'R0153:Olfr954'
ID22842
Institutional Source Beutler Lab
Gene Symbol Olfr954
Ensembl Gene ENSMUSG00000094745
Gene Nameolfactory receptor 954
SynonymsGA_x6K02T2PVTD-33158015-33158950, MOR171-53, MOR171-42
MMRRC Submission 038436-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R0153 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location39456701-39464625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39461671 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 80 (V80A)
Ref Sequence ENSEMBL: ENSMUSP00000079205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080329] [ENSMUST00000214818]
Predicted Effect probably damaging
Transcript: ENSMUST00000080329
AA Change: V80A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079205
Gene: ENSMUSG00000094745
AA Change: V80A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 38 264 3e-5 PFAM
Pfam:7tm_1 44 293 1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214818
AA Change: V77A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik G T 9: 94,524,480 D291E probably benign Het
2010300C02Rik A G 1: 37,624,639 V726A probably benign Het
Abcb9 T C 5: 124,080,056 M406V probably benign Het
Adar T C 3: 89,730,814 S2P probably benign Het
Adgre1 T A 17: 57,443,939 S538T possibly damaging Het
Alms1 T A 6: 85,641,381 I2803N possibly damaging Het
Amn1 G T 6: 149,188,593 probably benign Het
Arid1b G A 17: 5,342,932 A2246T probably damaging Het
BC024139 T C 15: 76,121,747 E418G probably damaging Het
Bok A G 1: 93,686,517 D24G probably damaging Het
Cabp2 T C 19: 4,084,913 probably benign Het
Ccdc141 C A 2: 77,165,238 probably benign Het
Ccdc178 T C 18: 22,150,435 T13A probably benign Het
Ccdc42 G T 11: 68,587,650 V33F possibly damaging Het
Clcn7 G A 17: 25,149,202 probably benign Het
Cluh A G 11: 74,657,350 probably benign Het
Cr1l A T 1: 195,114,856 probably benign Het
Csnk1g3 T A 18: 53,918,789 probably benign Het
Depdc5 T C 5: 32,933,937 probably benign Het
Dgkh A C 14: 78,570,129 Y1149* probably null Het
Dnaic1 A G 4: 41,635,162 probably benign Het
Efcab2 A G 1: 178,474,886 E65G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam71e2 A T 7: 4,770,287 L177Q probably damaging Het
Fgfr4 A G 13: 55,161,385 probably benign Het
Gm10720 A C 9: 3,015,787 S44R probably null Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm6471 A T 7: 142,831,631 noncoding transcript Het
Gm8994 A T 6: 136,328,844 D101V probably damaging Het
Hnrnpm C T 17: 33,646,515 R724Q probably damaging Het
Homer1 C T 13: 93,391,746 T117I possibly damaging Het
Hoxd4 A T 2: 74,727,457 Q60L probably damaging Het
Ift172 T C 5: 31,260,624 R1274G probably benign Het
Ino80d A G 1: 63,058,318 S806P probably damaging Het
Itga10 T C 3: 96,653,700 V627A probably benign Het
Itgb2l A G 16: 96,437,369 Y77H possibly damaging Het
Kel A T 6: 41,701,943 H195Q probably benign Het
Klhdc7a A G 4: 139,967,271 S122P possibly damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Lats1 T A 10: 7,691,575 S37T probably damaging Het
Lrp1b T A 2: 41,123,019 H1858L possibly damaging Het
Matk A T 10: 81,262,842 T461S probably benign Het
Meikin A G 11: 54,409,642 probably benign Het
Muc6 T C 7: 141,634,116 Q2832R possibly damaging Het
Myo10 T C 15: 25,781,238 F194L possibly damaging Het
Nbas G A 12: 13,273,876 probably benign Het
Nme4 A G 17: 26,093,857 probably null Het
Olfr1136 A G 2: 87,693,604 S93P probably benign Het
Olfr1217 T A 2: 89,023,196 N269I probably benign Het
Olfr1340 A T 4: 118,726,333 I29F possibly damaging Het
Olfr851 T A 9: 19,496,937 L63H probably damaging Het
Pacsin2 T C 15: 83,377,661 Q473R probably benign Het
Patz1 A G 11: 3,293,288 H427R probably damaging Het
Pkp3 A G 7: 141,083,343 Y367C probably damaging Het
Prdm2 G A 4: 143,133,768 P984L possibly damaging Het
Rev3l T A 10: 39,874,128 C3091* probably null Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpl5 T C 5: 107,904,757 F140L probably benign Het
Sec24a A C 11: 51,700,826 I1014M probably benign Het
Serpinb11 A G 1: 107,372,203 H93R probably benign Het
Shank2 C A 7: 144,070,135 H286N probably benign Het
Sipa1l2 G T 8: 125,421,898 Q1651K probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc30a5 A T 13: 100,826,494 F75L possibly damaging Het
Slco1a1 G T 6: 141,910,701 probably benign Het
Smg5 C T 3: 88,353,872 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Taf8 A T 17: 47,498,252 probably benign Het
Tarsl2 A G 7: 65,684,081 D617G probably damaging Het
Tbc1d5 A T 17: 50,984,687 probably benign Het
Tfcp2 C G 15: 100,514,827 E315Q probably damaging Het
Tmf1 A T 6: 97,170,384 S540R probably damaging Het
Tmprss4 T C 9: 45,184,336 Q70R probably benign Het
Trip13 G T 13: 73,920,064 A266E possibly damaging Het
Ttc24 T A 3: 88,074,927 probably benign Het
Ttll5 T A 12: 85,831,966 I49N probably damaging Het
Ube2ql1 A T 13: 69,738,592 M250K possibly damaging Het
Vmn1r87 A T 7: 13,132,284 D25E probably damaging Het
Vmn2r84 A G 10: 130,392,008 Y120H probably benign Het
Wdr6 G A 9: 108,575,242 R481C probably damaging Het
Wdr60 A G 12: 116,232,636 V497A probably benign Het
Zcchc6 G A 13: 59,782,336 R962* probably null Het
Zdhhc17 A T 10: 110,955,094 Y371* probably null Het
Zfp292 T C 4: 34,811,185 N620D probably benign Het
Zfp932 T A 5: 110,006,968 Y11N probably benign Het
Other mutations in Olfr954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02704:Olfr954 APN 9 39462283 missense probably damaging 0.98
IGL02793:Olfr954 APN 9 39461506 missense probably benign 0.09
IGL02964:Olfr954 APN 9 39461781 missense possibly damaging 0.88
IGL02979:Olfr954 APN 9 39461523 missense probably benign 0.02
R0041:Olfr954 UTSW 9 39461476 missense probably benign 0.34
R0269:Olfr954 UTSW 9 39461794 missense probably damaging 1.00
R0426:Olfr954 UTSW 9 39461593 missense probably damaging 1.00
R0731:Olfr954 UTSW 9 39461532 missense probably damaging 1.00
R1800:Olfr954 UTSW 9 39462114 missense probably damaging 1.00
R2340:Olfr954 UTSW 9 39461809 missense probably damaging 1.00
R2901:Olfr954 UTSW 9 39461938 missense probably damaging 0.97
R2912:Olfr954 UTSW 9 39462216 missense probably damaging 1.00
R2939:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R2940:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3081:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3765:Olfr954 UTSW 9 39461624 nonsense probably null
R4450:Olfr954 UTSW 9 39462032 missense probably benign 0.00
R4515:Olfr954 UTSW 9 39462231 nonsense probably null
R4786:Olfr954 UTSW 9 39461841 missense probably benign 0.16
R4961:Olfr954 UTSW 9 39461887 missense probably damaging 1.00
R5219:Olfr954 UTSW 9 39462267 missense probably benign 0.09
R5602:Olfr954 UTSW 9 39462030 missense probably benign 0.00
R5887:Olfr954 UTSW 9 39461491 missense probably damaging 1.00
R5950:Olfr954 UTSW 9 39462337 missense probably benign 0.01
R6943:Olfr954 UTSW 9 39461863 missense probably benign 0.05
R7567:Olfr954 UTSW 9 39461877 missense possibly damaging 0.92
X0060:Olfr954 UTSW 9 39462274 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGAGCAGTCAGAACTCCAGC -3'
(R):5'- ACCTGCCCTCACTAGAGCTAATGC -3'

Sequencing Primer
(F):5'- AGCTGCCCCTGTTCCTC -3'
(R):5'- GAAGCCCATGTTTACTGATGCAC -3'
Posted On2013-04-16