Incidental Mutation 'R2058:St8sia5'
ID228424
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
MMRRC Submission 040063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2058 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77254763 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 390 (I390F)
Ref Sequence ENSEMBL: ENSMUSP00000074764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect probably damaging
Transcript: ENSMUST00000075290
AA Change: I390F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: I390F

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079618
AA Change: I354F

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: I354F

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Meta Mutation Damage Score 0.3358 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,672,066 probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Arhgap18 C T 10: 26,854,908 T122I probably benign Het
Arhgef4 A G 1: 34,722,377 K238R unknown Het
Atf6b A T 17: 34,648,575 probably null Het
Atp2a1 G A 7: 126,447,672 A847V possibly damaging Het
Baz1b T A 5: 135,217,225 N509K probably benign Het
BC051076 A T 5: 87,963,985 noncoding transcript Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Cd302 T A 2: 60,252,423 I186F possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cep112 T A 11: 108,519,261 probably null Het
Cmtm4 A C 8: 104,355,288 F156V probably damaging Het
Col4a1 T A 8: 11,210,792 D1330V probably damaging Het
Ctsa T G 2: 164,834,902 M136R probably null Het
Cyp2d10 T A 15: 82,403,814 I363F probably damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Gcc2 T A 10: 58,285,957 S1102T probably benign Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gna14 G C 19: 16,608,141 probably benign Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Gulo A G 14: 65,991,159 V270A possibly damaging Het
Hps5 T A 7: 46,768,051 D904V probably damaging Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Jak3 A T 8: 71,685,383 probably null Het
Klhl6 T G 16: 19,982,931 T25P probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Map3k21 A G 8: 125,938,722 K550R probably benign Het
Mphosph10 T A 7: 64,376,751 L650F probably damaging Het
Mrpl48 T C 7: 100,549,333 E204G probably damaging Het
Msh5 A C 17: 35,029,756 V738G probably damaging Het
Mybph G A 1: 134,200,119 C473Y probably damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Notch3 T C 17: 32,143,644 T1336A probably benign Het
Nsun4 T C 4: 116,053,680 probably null Het
Olfr1023 A T 2: 85,886,952 T51S possibly damaging Het
Olfr390 A G 11: 73,787,274 N112S probably benign Het
Osgin1 A G 8: 119,445,673 D402G possibly damaging Het
Patl1 A G 19: 11,932,147 E479G possibly damaging Het
Pbsn T C X: 77,847,976 K72E probably damaging Het
Pcdhb13 A G 18: 37,444,567 Q666R possibly damaging Het
Pi4k2b G A 5: 52,750,680 V131I probably benign Het
Pkn2 G A 3: 142,853,471 H98Y possibly damaging Het
Pms1 A G 1: 53,275,168 Y73H probably benign Het
Ppt2 A T 17: 34,622,844 probably benign Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prl6a1 T C 13: 27,319,098 Y231H probably benign Het
Ranbp3l T A 15: 9,000,817 V41D probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Ripk4 A T 16: 97,744,142 L372* probably null Het
Rnf126 A G 10: 79,759,137 probably benign Het
S100pbp A G 4: 129,182,100 V144A probably benign Het
Saal1 T C 7: 46,699,456 Q317R probably damaging Het
Sap25 G A 5: 137,642,772 G277R probably damaging Het
Senp2 C T 16: 22,014,199 T79I probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Set A G 2: 30,069,036 K70E possibly damaging Het
Setd3 A G 12: 108,107,341 I559T probably benign Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Skint3 A T 4: 112,255,783 K197* probably null Het
Skint5 T A 4: 113,870,700 I402F possibly damaging Het
Slc18a1 G A 8: 69,043,961 T350M probably damaging Het
Slc19a3 A T 1: 83,014,791 I403K probably damaging Het
Slc1a7 C T 4: 108,004,439 T225I probably benign Het
Slc38a4 T C 15: 97,008,725 I336V probably benign Het
Smarcc1 A G 9: 110,118,343 probably benign Het
Strc A T 2: 121,378,887 W290R probably damaging Het
Svep1 T C 4: 58,084,554 D1858G possibly damaging Het
Sympk G A 7: 19,043,529 R568Q probably damaging Het
Tex44 A C 1: 86,427,006 K212N probably damaging Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Thrap3 C T 4: 126,180,174 V260I probably damaging Het
Thsd7a A T 6: 12,318,106 probably benign Het
Trim12c A G 7: 104,348,191 F53L possibly damaging Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ubap2l A T 3: 90,031,376 probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Usp17la A C 7: 104,861,171 T328P probably damaging Het
Vmn2r113 T A 17: 22,958,249 L669* probably null Het
Vps13b T A 15: 35,841,447 V2541E probably damaging Het
Wnt3 T C 11: 103,812,285 I198T probably damaging Het
Zfp316 T C 5: 143,263,406 E158G unknown Het
Zfp362 T G 4: 128,786,987 I182L possibly damaging Het
Zfp804a A G 2: 82,257,366 D513G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Zfp97 T A 17: 17,144,756 N172K possibly damaging Het
Zmym6 A T 4: 127,088,415 K82* probably null Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77254662 missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0392:St8sia5 UTSW 18 77254406 missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77254464 missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77232806 missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77246140 missense probably damaging 0.98
R7020:St8sia5 UTSW 18 77246180 missense probably damaging 0.97
R7087:St8sia5 UTSW 18 77254542 missense possibly damaging 0.88
R7784:St8sia5 UTSW 18 77254550 missense probably benign 0.36
R8037:St8sia5 UTSW 18 77248542 missense possibly damaging 0.95
R8153:St8sia5 UTSW 18 77253111 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTACCTGAGCAGTGTGTCG -3'
(R):5'- AGACCTGGATCTGTGCTCTATC -3'

Sequencing Primer
(F):5'- AGCAGTGTGTCGCGCTAC -3'
(R):5'- GATCTGTGCTCTATCCTGTTAAATG -3'
Posted On2014-09-17