Mutagenetix > Incidental Mutations

Incidental Mutation 'R2059:Kdm5b'

228431

Institutional Source

Beutler Lab

Gene Symbol

Kdm5b

Ensembl Gene

ENSMUSG00000042207

Gene Name

lysine (K)-specific demethylase 5B

Synonyms

Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e

MMRRC Submission

040064-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.374) question?

Stock #

R2059 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134560171-134635285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 134613214 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 681 (D681E)

Ref Sequence

ENSEMBL: ENSMUSP00000107817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]

PDB Structure

Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000047714
AA Change: D681E

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: D681E

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	744	2.2e-17	PFAM
Pfam:PLU-1	757	1088	5.6e-92	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC
PHD	1486	1536	1.18e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112198
AA Change: D681E

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: D681E

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	745	6.7e-21	PFAM
Pfam:PLU-1	756	1088	6e-94	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	G	A	6: 41,032,381	T173I	probably benign	Het
Adgrf3	G	A	5: 30,199,491	H316Y	possibly damaging	Het
Adgrf5	A	G	17: 43,428,586	Y72C	possibly damaging	Het
Ak5	T	A	3: 152,660,637	L42F	probably damaging	Het
Alas1	T	C	9: 106,241,290	E211G	probably damaging	Het
Alkbh1	C	T	12: 87,443,750		probably benign	Het
Als2cl	T	C	9: 110,885,438	V118A	probably benign	Het
Ano1	G	C	7: 144,611,390	L641V	probably damaging	Het
Arfgef1	C	T	1: 10,188,752		probably null	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Atf7ip	T	G	6: 136,609,348		probably benign	Het
Atp2b4	G	T	1: 133,726,537	Q777K	probably benign	Het
Baz2a	T	A	10: 128,113,578	S347R	probably damaging	Het
C2cd3	T	C	7: 100,455,493		probably benign	Het
Cage1	A	G	13: 38,023,380	V163A	probably benign	Het
Cdh12	T	A	15: 21,583,740	N555K	probably benign	Het
Cenpj	G	A	14: 56,563,955	P187L	possibly damaging	Het
Cep112	T	A	11: 108,519,261		probably null	Het
Cfap54	A	T	10: 92,942,979		probably benign	Het
Cgref1	T	G	5: 30,933,645	D275A	possibly damaging	Het
Clgn	A	C	8: 83,399,978	N103H	probably benign	Het
Corin	A	G	5: 72,316,051	V905A	possibly damaging	Het
Csta1	A	C	16: 36,122,322	D72E	probably benign	Het
Cul5	A	T	9: 53,667,156	L44Q	probably damaging	Het
Dmbt1	G	A	7: 131,106,170	A1381T	possibly damaging	Het
Dync1i2	G	A	2: 71,249,853		probably null	Het
Enoph1	A	G	5: 100,059,219	D55G	probably damaging	Het
Fam160b2	A	G	14: 70,585,049	V744A	possibly damaging	Het
Fat4	T	A	3: 38,891,170	M1404K	possibly damaging	Het
Foxi2	G	T	7: 135,410,677	G98V	probably damaging	Het
Galr2	T	C	11: 116,282,939	S132P	probably damaging	Het
Gcm2	T	C	13: 41,109,954	M1V	probably null	Het
Gm15446	C	T	5: 109,942,496	H205Y	probably damaging	Het
Gm21775	T	A	Y: 10,553,910	I153N	probably benign	Het
Grip1	A	G	10: 120,038,698	K789R	possibly damaging	Het
Gsk3b	T	A	16: 38,187,909	D192E	probably benign	Het
Herc2	T	A	7: 56,163,897	H2625Q	probably damaging	Het
Hoxc9	A	G	15: 102,984,123	D256G	probably benign	Het
Il7	A	T	3: 7,573,915	N130K	probably damaging	Het
Irf2	A	T	8: 46,807,345	N104I	probably damaging	Het
Kat6a	A	G	8: 22,939,305	N1559D	possibly damaging	Het
Kcnq4	G	T	4: 120,698,002	F661L	probably benign	Het
Khdrbs1	T	C	4: 129,725,721	E209G	probably damaging	Het
Lama3	A	T	18: 12,528,333	R2116S	probably damaging	Het
Mir124-2hg	C	A	3: 17,785,713	E65*	probably null	Het
Mphosph10	T	A	7: 64,376,751	L650F	probably damaging	Het
Mrpl48	T	C	7: 100,549,333	E204G	probably damaging	Het
Msl3l2	T	A	10: 56,115,944	L255Q	probably damaging	Het
Mx1	T	A	16: 97,454,179	K225*	probably null	Het
Nf1	T	C	11: 79,556,723	V435A	probably damaging	Het
Nid1	A	C	13: 13,500,473	H926P	probably benign	Het
Nlrp9a	T	A	7: 26,557,362	I46K	possibly damaging	Het
Nop2	T	A	6: 125,139,860	M359K	probably null	Het
Nox1	T	C	X: 134,095,244		probably benign	Het
Ogdhl	G	A	14: 32,332,884	R263K	probably damaging	Het
Olfr1388	T	A	11: 49,444,451	V200E	probably damaging	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Pbsn	T	C	X: 77,847,976	K72E	probably damaging	Het
Pde12	T	C	14: 26,668,880	I225V	probably benign	Het
Ppt2	A	T	17: 34,622,844		probably benign	Het
Prl3a1	A	G	13: 27,270,144	D35G	probably benign	Het
Ptprk	T	A	10: 28,566,603	I893N	probably damaging	Het
Ptprz1	T	C	6: 22,986,323		probably benign	Het
Rab3c	A	G	13: 110,260,516	V72A	probably damaging	Het
Rbms2	A	G	10: 128,137,518	S251P	probably benign	Het
Rfwd3	A	G	8: 111,297,495	V65A	probably benign	Het
Rps6kl1	T	A	12: 85,139,623	Y211F	probably benign	Het
Saal1	T	C	7: 46,699,456	Q317R	probably damaging	Het
Scg3	T	C	9: 75,665,716	D311G	probably damaging	Het
Sdk2	C	A	11: 113,854,332	M712I	probably damaging	Het
Serinc2	T	G	4: 130,260,785	Y158S	probably damaging	Het
Serpinb9c	A	T	13: 33,156,871	C81*	probably null	Het
Sgpp2	T	A	1: 78,416,951	L197Q	probably damaging	Het
Shroom3	A	T	5: 92,683,784	T40S	probably damaging	Het
Sik1	A	G	17: 31,848,797	S435P	probably benign	Het
Slc7a3	A	G	X: 101,080,767	V464A	probably benign	Het
Snd1	T	C	6: 28,745,207	F517S	probably damaging	Het
Spata13	A	C	14: 60,759,591	I1165L	possibly damaging	Het
St8sia5	A	T	18: 77,254,763	I390F	probably damaging	Het
Stat5b	A	T	11: 100,787,332	S652T	probably benign	Het
Stom	A	G	2: 35,316,025	S231P	probably damaging	Het
Sult1b1	A	G	5: 87,535,033	Y18H	probably damaging	Het
Tgm4	T	C	9: 123,061,770	I54T	probably damaging	Het
Tmem176b	G	A	6: 48,836,333	T64I	probably damaging	Het
Tmem87a	A	T	2: 120,369,292	I457N	probably damaging	Het
Trim12c	A	G	7: 104,348,191	F53L	possibly damaging	Het
Ttc6	T	A	12: 57,737,693	D1849E	probably benign	Het
Ubap2l	A	T	3: 90,031,376		probably benign	Het
Ush2a	T	G	1: 188,381,549		probably null	Het
Usp17la	A	C	7: 104,861,171	T328P	probably damaging	Het
Ust	A	G	10: 8,207,566	Y349H	probably damaging	Het
V1rd19	A	T	7: 24,003,834	M242L	probably benign	Het
Vmn1r33	T	A	6: 66,612,202	M123L	probably benign	Het
Vps13c	A	T	9: 67,860,833	K111N	probably damaging	Het
Vwa3a	A	G	7: 120,758,949	D81G	probably damaging	Het
Zfp318	G	A	17: 46,397,024	R336Q	probably damaging	Het
Zfp609	A	G	9: 65,704,434	S416P	possibly damaging	Het

Other mutations in Kdm5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kdm5b	APN	1	134620955	missense	probably damaging	1.00
IGL01458:Kdm5b	APN	1	134621986	missense	possibly damaging	0.53
IGL01567:Kdm5b	APN	1	134602540	missense	probably damaging	1.00
IGL01625:Kdm5b	APN	1	134617968	missense	possibly damaging	0.74
IGL01970:Kdm5b	APN	1	134600727	missense	probably damaging	1.00
IGL02183:Kdm5b	APN	1	134624931	missense	probably benign	0.09
IGL02592:Kdm5b	APN	1	134624853	missense	probably damaging	0.99
IGL02695:Kdm5b	APN	1	134604485	missense	possibly damaging	0.94
IGL02697:Kdm5b	APN	1	134588773	splice site	probably benign
IGL03036:Kdm5b	APN	1	134608937	missense	probably damaging	1.00
IGL03056:Kdm5b	APN	1	134587979	missense	probably damaging	0.99
IGL03206:Kdm5b	APN	1	134627317	missense	probably benign
IGL03342:Kdm5b	APN	1	134602576	missense	probably benign	0.00
IGL03388:Kdm5b	APN	1	134627322	missense	probably benign
amaryllis	UTSW	1	134609061	critical splice donor site	probably null
PIT4486001:Kdm5b	UTSW	1	134628685	missense	probably damaging	1.00
R0233:Kdm5b	UTSW	1	134604634	splice site	probably benign
R0334:Kdm5b	UTSW	1	134604522	missense	probably damaging	0.99
R0504:Kdm5b	UTSW	1	134621023	critical splice donor site	probably null
R0505:Kdm5b	UTSW	1	134602571	missense	probably damaging	0.96
R0521:Kdm5b	UTSW	1	134618033	missense	possibly damaging	0.65
R1004:Kdm5b	UTSW	1	134588904	missense	possibly damaging	0.71
R1087:Kdm5b	UTSW	1	134600637	missense	probably damaging	1.00
R1126:Kdm5b	UTSW	1	134613991	missense	possibly damaging	0.90
R1221:Kdm5b	UTSW	1	134599091	missense	probably damaging	0.98
R1230:Kdm5b	UTSW	1	134613254	missense	probably damaging	1.00
R1345:Kdm5b	UTSW	1	134630550	missense	possibly damaging	0.94
R1482:Kdm5b	UTSW	1	134624897	missense	probably damaging	1.00
R1582:Kdm5b	UTSW	1	134624853	missense	probably damaging	0.99
R1653:Kdm5b	UTSW	1	134602481	missense	probably damaging	1.00
R1693:Kdm5b	UTSW	1	134597576	splice site	probably benign
R1721:Kdm5b	UTSW	1	134613181	splice site	probably benign
R1741:Kdm5b	UTSW	1	134618017	missense	possibly damaging	0.82
R1762:Kdm5b	UTSW	1	134604467	nonsense	probably null
R1820:Kdm5b	UTSW	1	134597670	missense	possibly damaging	0.87
R1872:Kdm5b	UTSW	1	134624994	missense	probably damaging	1.00
R1966:Kdm5b	UTSW	1	134613873	splice site	probably null
R2056:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2405:Kdm5b	UTSW	1	134609016	missense	probably damaging	0.97
R3417:Kdm5b	UTSW	1	134587977	missense	probably damaging	1.00
R3771:Kdm5b	UTSW	1	134613345	missense	probably damaging	1.00
R3783:Kdm5b	UTSW	1	134630542	missense	probably benign
R3803:Kdm5b	UTSW	1	134615941	missense	probably benign	0.07
R3980:Kdm5b	UTSW	1	134619670	missense	probably benign	0.11
R3983:Kdm5b	UTSW	1	134631304	missense	possibly damaging	0.91
R4013:Kdm5b	UTSW	1	134627329	missense	possibly damaging	0.86
R4162:Kdm5b	UTSW	1	134625161	missense	probably benign	0.01
R4701:Kdm5b	UTSW	1	134606012	intron	probably benign
R4791:Kdm5b	UTSW	1	134630800	missense	possibly damaging	0.82
R4836:Kdm5b	UTSW	1	134593315	splice site	probably null
R4924:Kdm5b	UTSW	1	134631351	missense	probably benign	0.00
R5135:Kdm5b	UTSW	1	134588746	intron	probably benign
R5248:Kdm5b	UTSW	1	134620997	missense	probably benign	0.11
R5290:Kdm5b	UTSW	1	134622099	splice site	probably null
R5358:Kdm5b	UTSW	1	134607694	nonsense	probably null
R5388:Kdm5b	UTSW	1	134608897	nonsense	probably null
R5396:Kdm5b	UTSW	1	134622098	splice site	probably null
R5397:Kdm5b	UTSW	1	134622098	splice site	probably null
R5398:Kdm5b	UTSW	1	134622098	splice site	probably null
R5399:Kdm5b	UTSW	1	134622098	splice site	probably null
R5529:Kdm5b	UTSW	1	134588003	missense	probably damaging	1.00
R5540:Kdm5b	UTSW	1	134631241	missense	probably damaging	0.98
R5661:Kdm5b	UTSW	1	134599073	missense	probably benign	0.01
R5663:Kdm5b	UTSW	1	134630635	missense	probably benign
R5822:Kdm5b	UTSW	1	134588773	splice site	probably benign
R6226:Kdm5b	UTSW	1	134608878	missense	probably damaging	0.99
R6368:Kdm5b	UTSW	1	134599207	missense	probably damaging	1.00
R6681:Kdm5b	UTSW	1	134613269	missense	possibly damaging	0.90
R6715:Kdm5b	UTSW	1	134609061	critical splice donor site	probably null
R7132:Kdm5b	UTSW	1	134599106	missense	probably damaging	1.00
R7202:Kdm5b	UTSW	1	134624759	missense	probably benign
R7258:Kdm5b	UTSW	1	134621021	missense	probably damaging	1.00
R7335:Kdm5b	UTSW	1	134560439	missense	probably damaging	1.00
R7420:Kdm5b	UTSW	1	134604497	missense	probably benign	0.14
R7426:Kdm5b	UTSW	1	134595833	missense	probably benign	0.02
R7452:Kdm5b	UTSW	1	134624948	missense	probably damaging	1.00
R7595:Kdm5b	UTSW	1	134608966	missense	probably benign	0.00
R7612:Kdm5b	UTSW	1	134624918	nonsense	probably null
R7704:Kdm5b	UTSW	1	134587931	missense	probably damaging	1.00
R7846:Kdm5b	UTSW	1	134617840	missense	probably damaging	1.00
R8115:Kdm5b	UTSW	1	134619673	missense	possibly damaging	0.83
R8146:Kdm5b	UTSW	1	134625126	missense	probably benign	0.05
R8160:Kdm5b	UTSW	1	134613919	missense	probably damaging	1.00
X0063:Kdm5b	UTSW	1	134588876	missense	probably benign	0.07
Z1176:Kdm5b	UTSW	1	134625035	missense	probably damaging	1.00
Z1177:Kdm5b	UTSW	1	134595798	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCCTCATCCAAAGAAGGATTCTC -3'
(R):5'- AACTCATCCTTACTTACCGCAG -3'

Sequencing Primer
(F):5'- TCTGTCTTCAGATACGCTAGAAGAGG -3'
(R):5'- CGCAGGTTATACTTATACGGGG -3'

Posted On

2014-09-17