Mutagenetix > Incidental Mutation

Incidental Mutation 'R2059:Shroom3'

228448

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

040064-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2059 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92683784 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 40 (T40S)

Ref Sequence

ENSEMBL: ENSMUSP00000108678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113055] [ENSMUST00000168878]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000113055
AA Change: T40S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: T40S

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168878
AA Change: T40S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: T40S

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Meta Mutation Damage Score

0.2084

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	G	A	6: 41,032,381	T173I	probably benign	Het
Adgrf3	G	A	5: 30,199,491	H316Y	possibly damaging	Het
Adgrf5	A	G	17: 43,428,586	Y72C	possibly damaging	Het
Ak5	T	A	3: 152,660,637	L42F	probably damaging	Het
Alas1	T	C	9: 106,241,290	E211G	probably damaging	Het
Alkbh1	C	T	12: 87,443,750		probably benign	Het
Als2cl	T	C	9: 110,885,438	V118A	probably benign	Het
Ano1	G	C	7: 144,611,390	L641V	probably damaging	Het
Arfgef1	C	T	1: 10,188,752		probably null	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Atf7ip	T	G	6: 136,609,348		probably benign	Het
Atp2b4	G	T	1: 133,726,537	Q777K	probably benign	Het
Baz2a	T	A	10: 128,113,578	S347R	probably damaging	Het
C2cd3	T	C	7: 100,455,493		probably benign	Het
Cage1	A	G	13: 38,023,380	V163A	probably benign	Het
Cdh12	T	A	15: 21,583,740	N555K	probably benign	Het
Cenpj	G	A	14: 56,563,955	P187L	possibly damaging	Het
Cep112	T	A	11: 108,519,261		probably null	Het
Cfap54	A	T	10: 92,942,979		probably benign	Het
Cgref1	T	G	5: 30,933,645	D275A	possibly damaging	Het
Clgn	A	C	8: 83,399,978	N103H	probably benign	Het
Corin	A	G	5: 72,316,051	V905A	possibly damaging	Het
Csta1	A	C	16: 36,122,322	D72E	probably benign	Het
Cul5	A	T	9: 53,667,156	L44Q	probably damaging	Het
Dmbt1	G	A	7: 131,106,170	A1381T	possibly damaging	Het
Dync1i2	G	A	2: 71,249,853		probably null	Het
Enoph1	A	G	5: 100,059,219	D55G	probably damaging	Het
Fam160b2	A	G	14: 70,585,049	V744A	possibly damaging	Het
Fat4	T	A	3: 38,891,170	M1404K	possibly damaging	Het
Foxi2	G	T	7: 135,410,677	G98V	probably damaging	Het
Galr2	T	C	11: 116,282,939	S132P	probably damaging	Het
Gcm2	T	C	13: 41,109,954	M1V	probably null	Het
Gm15446	C	T	5: 109,942,496	H205Y	probably damaging	Het
Gm21775	T	A	Y: 10,553,910	I153N	probably benign	Het
Grip1	A	G	10: 120,038,698	K789R	possibly damaging	Het
Gsk3b	T	A	16: 38,187,909	D192E	probably benign	Het
Herc2	T	A	7: 56,163,897	H2625Q	probably damaging	Het
Hoxc9	A	G	15: 102,984,123	D256G	probably benign	Het
Il7	A	T	3: 7,573,915	N130K	probably damaging	Het
Irf2	A	T	8: 46,807,345	N104I	probably damaging	Het
Kat6a	A	G	8: 22,939,305	N1559D	possibly damaging	Het
Kcnq4	G	T	4: 120,698,002	F661L	probably benign	Het
Kdm5b	T	A	1: 134,613,214	D681E	probably benign	Het
Khdrbs1	T	C	4: 129,725,721	E209G	probably damaging	Het
Lama3	A	T	18: 12,528,333	R2116S	probably damaging	Het
Mir124-2hg	C	A	3: 17,785,713	E65*	probably null	Het
Mphosph10	T	A	7: 64,376,751	L650F	probably damaging	Het
Mrpl48	T	C	7: 100,549,333	E204G	probably damaging	Het
Msl3l2	T	A	10: 56,115,944	L255Q	probably damaging	Het
Mx1	T	A	16: 97,454,179	K225*	probably null	Het
Nf1	T	C	11: 79,556,723	V435A	probably damaging	Het
Nid1	A	C	13: 13,500,473	H926P	probably benign	Het
Nlrp9a	T	A	7: 26,557,362	I46K	possibly damaging	Het
Nop2	T	A	6: 125,139,860	M359K	probably null	Het
Nox1	T	C	X: 134,095,244		probably benign	Het
Ogdhl	G	A	14: 32,332,884	R263K	probably damaging	Het
Olfr1388	T	A	11: 49,444,451	V200E	probably damaging	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Pbsn	T	C	X: 77,847,976	K72E	probably damaging	Het
Pde12	T	C	14: 26,668,880	I225V	probably benign	Het
Ppt2	A	T	17: 34,622,844		probably benign	Het
Prl3a1	A	G	13: 27,270,144	D35G	probably benign	Het
Ptprk	T	A	10: 28,566,603	I893N	probably damaging	Het
Ptprz1	T	C	6: 22,986,323		probably benign	Het
Rab3c	A	G	13: 110,260,516	V72A	probably damaging	Het
Rbms2	A	G	10: 128,137,518	S251P	probably benign	Het
Rfwd3	A	G	8: 111,297,495	V65A	probably benign	Het
Rps6kl1	T	A	12: 85,139,623	Y211F	probably benign	Het
Saal1	T	C	7: 46,699,456	Q317R	probably damaging	Het
Scg3	T	C	9: 75,665,716	D311G	probably damaging	Het
Sdk2	C	A	11: 113,854,332	M712I	probably damaging	Het
Serinc2	T	G	4: 130,260,785	Y158S	probably damaging	Het
Serpinb9c	A	T	13: 33,156,871	C81*	probably null	Het
Sgpp2	T	A	1: 78,416,951	L197Q	probably damaging	Het
Sik1	A	G	17: 31,848,797	S435P	probably benign	Het
Slc7a3	A	G	X: 101,080,767	V464A	probably benign	Het
Snd1	T	C	6: 28,745,207	F517S	probably damaging	Het
Spata13	A	C	14: 60,759,591	I1165L	possibly damaging	Het
St8sia5	A	T	18: 77,254,763	I390F	probably damaging	Het
Stat5b	A	T	11: 100,787,332	S652T	probably benign	Het
Stom	A	G	2: 35,316,025	S231P	probably damaging	Het
Sult1b1	A	G	5: 87,535,033	Y18H	probably damaging	Het
Tgm4	T	C	9: 123,061,770	I54T	probably damaging	Het
Tmem176b	G	A	6: 48,836,333	T64I	probably damaging	Het
Tmem87a	A	T	2: 120,369,292	I457N	probably damaging	Het
Trim12c	A	G	7: 104,348,191	F53L	possibly damaging	Het
Ttc6	T	A	12: 57,737,693	D1849E	probably benign	Het
Ubap2l	A	T	3: 90,031,376		probably benign	Het
Ush2a	T	G	1: 188,381,549		probably null	Het
Usp17la	A	C	7: 104,861,171	T328P	probably damaging	Het
Ust	A	G	10: 8,207,566	Y349H	probably damaging	Het
V1rd19	A	T	7: 24,003,834	M242L	probably benign	Het
Vmn1r33	T	A	6: 66,612,202	M123L	probably benign	Het
Vps13c	A	T	9: 67,860,833	K111N	probably damaging	Het
Vwa3a	A	G	7: 120,758,949	D81G	probably damaging	Het
Zfp318	G	A	17: 46,397,024	R336Q	probably damaging	Het
Zfp609	A	G	9: 65,704,434	S416P	possibly damaging	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGAGCGATCTAACCCAGCAG -3'
(R):5'- TGCAGTTCAGGCAACGAAC -3'

Sequencing Primer
(F):5'- AGCAGGGAAGCTCCTCTTG -3'
(R):5'- CAGGCAACGAACAGGATTTTTC -3'

Posted On

2014-09-17