Mutagenetix > Incidental Mutation

Incidental Mutation 'R0153:Lats1'

22846

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

038436-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R0153 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 7691575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 37 (S37T)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: S37T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: S37T

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: S37T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: S37T

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: S37T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.1100

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

97% (99/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	G	T	9: 94,524,480	D291E	probably benign	Het
2010300C02Rik	A	G	1: 37,624,639	V726A	probably benign	Het
Abcb9	T	C	5: 124,080,056	M406V	probably benign	Het
Adar	T	C	3: 89,730,814	S2P	probably benign	Het
Adgre1	T	A	17: 57,443,939	S538T	possibly damaging	Het
Alms1	T	A	6: 85,641,381	I2803N	possibly damaging	Het
Amn1	G	T	6: 149,188,593		probably benign	Het
Arid1b	G	A	17: 5,342,932	A2246T	probably damaging	Het
BC024139	T	C	15: 76,121,747	E418G	probably damaging	Het
Bok	A	G	1: 93,686,517	D24G	probably damaging	Het
Cabp2	T	C	19: 4,084,913		probably benign	Het
Ccdc141	C	A	2: 77,165,238		probably benign	Het
Ccdc178	T	C	18: 22,150,435	T13A	probably benign	Het
Ccdc42	G	T	11: 68,587,650	V33F	possibly damaging	Het
Clcn7	G	A	17: 25,149,202		probably benign	Het
Cluh	A	G	11: 74,657,350		probably benign	Het
Cr1l	A	T	1: 195,114,856		probably benign	Het
Csnk1g3	T	A	18: 53,918,789		probably benign	Het
Depdc5	T	C	5: 32,933,937		probably benign	Het
Dgkh	A	C	14: 78,570,129	Y1149*	probably null	Het
Dnaic1	A	G	4: 41,635,162		probably benign	Het
Efcab2	A	G	1: 178,474,886	E65G	possibly damaging	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Fam71e2	A	T	7: 4,770,287	L177Q	probably damaging	Het
Fgfr4	A	G	13: 55,161,385		probably benign	Het
Gm10720	A	C	9: 3,015,787	S44R	probably null	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm6471	A	T	7: 142,831,631		noncoding transcript	Het
Gm8994	A	T	6: 136,328,844	D101V	probably damaging	Het
Hnrnpm	C	T	17: 33,646,515	R724Q	probably damaging	Het
Homer1	C	T	13: 93,391,746	T117I	possibly damaging	Het
Hoxd4	A	T	2: 74,727,457	Q60L	probably damaging	Het
Ift172	T	C	5: 31,260,624	R1274G	probably benign	Het
Ino80d	A	G	1: 63,058,318	S806P	probably damaging	Het
Itga10	T	C	3: 96,653,700	V627A	probably benign	Het
Itgb2l	A	G	16: 96,437,369	Y77H	possibly damaging	Het
Kel	A	T	6: 41,701,943	H195Q	probably benign	Het
Klhdc7a	A	G	4: 139,967,271	S122P	possibly damaging	Het
Krt71	T	A	15: 101,734,706	I456F	possibly damaging	Het
Lrp1b	T	A	2: 41,123,019	H1858L	possibly damaging	Het
Matk	A	T	10: 81,262,842	T461S	probably benign	Het
Meikin	A	G	11: 54,409,642		probably benign	Het
Muc6	T	C	7: 141,634,116	Q2832R	possibly damaging	Het
Myo10	T	C	15: 25,781,238	F194L	possibly damaging	Het
Nbas	G	A	12: 13,273,876		probably benign	Het
Nme4	A	G	17: 26,093,857		probably null	Het
Olfr1136	A	G	2: 87,693,604	S93P	probably benign	Het
Olfr1217	T	A	2: 89,023,196	N269I	probably benign	Het
Olfr1340	A	T	4: 118,726,333	I29F	possibly damaging	Het
Olfr851	T	A	9: 19,496,937	L63H	probably damaging	Het
Olfr954	T	C	9: 39,461,671	V80A	probably damaging	Het
Pacsin2	T	C	15: 83,377,661	Q473R	probably benign	Het
Patz1	A	G	11: 3,293,288	H427R	probably damaging	Het
Pkp3	A	G	7: 141,083,343	Y367C	probably damaging	Het
Prdm2	G	A	4: 143,133,768	P984L	possibly damaging	Het
Rev3l	T	A	10: 39,874,128	C3091*	probably null	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Rpl5	T	C	5: 107,904,757	F140L	probably benign	Het
Sec24a	A	C	11: 51,700,826	I1014M	probably benign	Het
Serpinb11	A	G	1: 107,372,203	H93R	probably benign	Het
Shank2	C	A	7: 144,070,135	H286N	probably benign	Het
Sipa1l2	G	T	8: 125,421,898	Q1651K	probably damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc30a5	A	T	13: 100,826,494	F75L	possibly damaging	Het
Slco1a1	G	T	6: 141,910,701		probably benign	Het
Smg5	C	T	3: 88,353,872		probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Taf8	A	T	17: 47,498,252		probably benign	Het
Tarsl2	A	G	7: 65,684,081	D617G	probably damaging	Het
Tbc1d5	A	T	17: 50,984,687		probably benign	Het
Tfcp2	C	G	15: 100,514,827	E315Q	probably damaging	Het
Tmf1	A	T	6: 97,170,384	S540R	probably damaging	Het
Tmprss4	T	C	9: 45,184,336	Q70R	probably benign	Het
Trip13	G	T	13: 73,920,064	A266E	possibly damaging	Het
Ttc24	T	A	3: 88,074,927		probably benign	Het
Ttll5	T	A	12: 85,831,966	I49N	probably damaging	Het
Ube2ql1	A	T	13: 69,738,592	M250K	possibly damaging	Het
Vmn1r87	A	T	7: 13,132,284	D25E	probably damaging	Het
Vmn2r84	A	G	10: 130,392,008	Y120H	probably benign	Het
Wdr6	G	A	9: 108,575,242	R481C	probably damaging	Het
Wdr60	A	G	12: 116,232,636	V497A	probably benign	Het
Zcchc6	G	A	13: 59,782,336	R962*	probably null	Het
Zdhhc17	A	T	10: 110,955,094	Y371*	probably null	Het
Zfp292	T	C	4: 34,811,185	N620D	probably benign	Het
Zfp932	T	A	5: 110,006,968	Y11N	probably benign	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAAGTCTGAGCAAGCAACTCCC -3'
(R):5'- GCCTGCAAATCCTGAAACATCTGTG -3'

Sequencing Primer
(F):5'- CTTTCACCTTGGCTCAGAAGAAG -3'
(R):5'- ATTAACTTCTGAAGGGCTCCG -3'

Posted On

2013-04-16