Mutagenetix > Incidental Mutation

Incidental Mutation 'R2059:Cfap54'

228489

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

040064-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R2059 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 92942979 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164979] [ENSMUST00000168110] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000067705

Predicted Effect

probably benign
Transcript: ENSMUST00000164979

SMART Domains

Protein: ENSMUSP00000129650
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	113	123	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000168110
AA Change: D1876E

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: D1876E

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000212902
AA Change: D1876E

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

99% (99/100)

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	G	A	6: 41,032,381	T173I	probably benign	Het
Adgrf3	G	A	5: 30,199,491	H316Y	possibly damaging	Het
Adgrf5	A	G	17: 43,428,586	Y72C	possibly damaging	Het
Ak5	T	A	3: 152,660,637	L42F	probably damaging	Het
Alas1	T	C	9: 106,241,290	E211G	probably damaging	Het
Alkbh1	C	T	12: 87,443,750		probably benign	Het
Als2cl	T	C	9: 110,885,438	V118A	probably benign	Het
Ano1	G	C	7: 144,611,390	L641V	probably damaging	Het
Arfgef1	C	T	1: 10,188,752		probably null	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Atf7ip	T	G	6: 136,609,348		probably benign	Het
Atp2b4	G	T	1: 133,726,537	Q777K	probably benign	Het
Baz2a	T	A	10: 128,113,578	S347R	probably damaging	Het
C2cd3	T	C	7: 100,455,493		probably benign	Het
Cage1	A	G	13: 38,023,380	V163A	probably benign	Het
Cdh12	T	A	15: 21,583,740	N555K	probably benign	Het
Cenpj	G	A	14: 56,563,955	P187L	possibly damaging	Het
Cep112	T	A	11: 108,519,261		probably null	Het
Cgref1	T	G	5: 30,933,645	D275A	possibly damaging	Het
Clgn	A	C	8: 83,399,978	N103H	probably benign	Het
Corin	A	G	5: 72,316,051	V905A	possibly damaging	Het
Csta1	A	C	16: 36,122,322	D72E	probably benign	Het
Cul5	A	T	9: 53,667,156	L44Q	probably damaging	Het
Dmbt1	G	A	7: 131,106,170	A1381T	possibly damaging	Het
Dync1i2	G	A	2: 71,249,853		probably null	Het
Enoph1	A	G	5: 100,059,219	D55G	probably damaging	Het
Fam160b2	A	G	14: 70,585,049	V744A	possibly damaging	Het
Fat4	T	A	3: 38,891,170	M1404K	possibly damaging	Het
Foxi2	G	T	7: 135,410,677	G98V	probably damaging	Het
Galr2	T	C	11: 116,282,939	S132P	probably damaging	Het
Gcm2	T	C	13: 41,109,954	M1V	probably null	Het
Gm15446	C	T	5: 109,942,496	H205Y	probably damaging	Het
Gm21775	T	A	Y: 10,553,910	I153N	probably benign	Het
Grip1	A	G	10: 120,038,698	K789R	possibly damaging	Het
Gsk3b	T	A	16: 38,187,909	D192E	probably benign	Het
Herc2	T	A	7: 56,163,897	H2625Q	probably damaging	Het
Hoxc9	A	G	15: 102,984,123	D256G	probably benign	Het
Il7	A	T	3: 7,573,915	N130K	probably damaging	Het
Irf2	A	T	8: 46,807,345	N104I	probably damaging	Het
Kat6a	A	G	8: 22,939,305	N1559D	possibly damaging	Het
Kcnq4	G	T	4: 120,698,002	F661L	probably benign	Het
Kdm5b	T	A	1: 134,613,214	D681E	probably benign	Het
Khdrbs1	T	C	4: 129,725,721	E209G	probably damaging	Het
Lama3	A	T	18: 12,528,333	R2116S	probably damaging	Het
Mir124-2hg	C	A	3: 17,785,713	E65*	probably null	Het
Mphosph10	T	A	7: 64,376,751	L650F	probably damaging	Het
Mrpl48	T	C	7: 100,549,333	E204G	probably damaging	Het
Msl3l2	T	A	10: 56,115,944	L255Q	probably damaging	Het
Mx1	T	A	16: 97,454,179	K225*	probably null	Het
Nf1	T	C	11: 79,556,723	V435A	probably damaging	Het
Nid1	A	C	13: 13,500,473	H926P	probably benign	Het
Nlrp9a	T	A	7: 26,557,362	I46K	possibly damaging	Het
Nop2	T	A	6: 125,139,860	M359K	probably null	Het
Nox1	T	C	X: 134,095,244		probably benign	Het
Ogdhl	G	A	14: 32,332,884	R263K	probably damaging	Het
Olfr1388	T	A	11: 49,444,451	V200E	probably damaging	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Pbsn	T	C	X: 77,847,976	K72E	probably damaging	Het
Pde12	T	C	14: 26,668,880	I225V	probably benign	Het
Ppt2	A	T	17: 34,622,844		probably benign	Het
Prl3a1	A	G	13: 27,270,144	D35G	probably benign	Het
Ptprk	T	A	10: 28,566,603	I893N	probably damaging	Het
Ptprz1	T	C	6: 22,986,323		probably benign	Het
Rab3c	A	G	13: 110,260,516	V72A	probably damaging	Het
Rbms2	A	G	10: 128,137,518	S251P	probably benign	Het
Rfwd3	A	G	8: 111,297,495	V65A	probably benign	Het
Rps6kl1	T	A	12: 85,139,623	Y211F	probably benign	Het
Saal1	T	C	7: 46,699,456	Q317R	probably damaging	Het
Scg3	T	C	9: 75,665,716	D311G	probably damaging	Het
Sdk2	C	A	11: 113,854,332	M712I	probably damaging	Het
Serinc2	T	G	4: 130,260,785	Y158S	probably damaging	Het
Serpinb9c	A	T	13: 33,156,871	C81*	probably null	Het
Sgpp2	T	A	1: 78,416,951	L197Q	probably damaging	Het
Shroom3	A	T	5: 92,683,784	T40S	probably damaging	Het
Sik1	A	G	17: 31,848,797	S435P	probably benign	Het
Slc7a3	A	G	X: 101,080,767	V464A	probably benign	Het
Snd1	T	C	6: 28,745,207	F517S	probably damaging	Het
Spata13	A	C	14: 60,759,591	I1165L	possibly damaging	Het
St8sia5	A	T	18: 77,254,763	I390F	probably damaging	Het
Stat5b	A	T	11: 100,787,332	S652T	probably benign	Het
Stom	A	G	2: 35,316,025	S231P	probably damaging	Het
Sult1b1	A	G	5: 87,535,033	Y18H	probably damaging	Het
Tgm4	T	C	9: 123,061,770	I54T	probably damaging	Het
Tmem176b	G	A	6: 48,836,333	T64I	probably damaging	Het
Tmem87a	A	T	2: 120,369,292	I457N	probably damaging	Het
Trim12c	A	G	7: 104,348,191	F53L	possibly damaging	Het
Ttc6	T	A	12: 57,737,693	D1849E	probably benign	Het
Ubap2l	A	T	3: 90,031,376		probably benign	Het
Ush2a	T	G	1: 188,381,549		probably null	Het
Usp17la	A	C	7: 104,861,171	T328P	probably damaging	Het
Ust	A	G	10: 8,207,566	Y349H	probably damaging	Het
V1rd19	A	T	7: 24,003,834	M242L	probably benign	Het
Vmn1r33	T	A	6: 66,612,202	M123L	probably benign	Het
Vps13c	A	T	9: 67,860,833	K111N	probably damaging	Het
Vwa3a	A	G	7: 120,758,949	D81G	probably damaging	Het
Zfp318	G	A	17: 46,397,024	R336Q	probably damaging	Het
Zfp609	A	G	9: 65,704,434	S416P	possibly damaging	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCAAGGGAAAGCATGCTG -3'
(R):5'- TACGTGTCAAATGCCTGCTAC -3'

Sequencing Primer
(F):5'- CATGCTGGGAAAAGAGGATTATG -3'
(R):5'- TGCCTGCTACAGATTGAAGC -3'

Posted On

2014-09-17