Incidental Mutation 'R2059:Baz2a'
ID228491
Institutional Source Beutler Lab
Gene Symbol Baz2a
Ensembl Gene ENSMUSG00000040054
Gene Namebromodomain adjacent to zinc finger domain, 2A
SynonymsC030005G16Rik, Tip5, Walp3
MMRRC Submission 040064-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2059 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128091577-128129303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128113578 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 347 (S347R)
Ref Sequence ENSEMBL: ENSMUSP00000151445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045621] [ENSMUST00000170054] [ENSMUST00000217851] [ENSMUST00000219072] [ENSMUST00000220049]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045621
AA Change: S344R

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044359
Gene: ENSMUSG00000040054
AA Change: S344R

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 421 475 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
MBD 539 614 3.87e-35 SMART
AT_hook 639 651 2.38e0 SMART
AT_hook 660 672 1.65e0 SMART
low complexity region 697 710 N/A INTRINSIC
coiled coil region 736 776 N/A INTRINSIC
DDT 837 902 3.75e-18 SMART
Pfam:WHIM1 939 988 4.8e-8 PFAM
low complexity region 1001 1013 N/A INTRINSIC
AT_hook 1174 1186 6.23e1 SMART
AT_hook 1388 1400 4.21e0 SMART
Pfam:WHIM3 1423 1464 1e-9 PFAM
PHD 1662 1708 1.47e-11 SMART
low complexity region 1741 1753 N/A INTRINSIC
BROMO 1773 1881 7.71e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170054
AA Change: S345R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129803
Gene: ENSMUSG00000040054
AA Change: S345R

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
low complexity region 422 476 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
MBD 540 615 3.87e-35 SMART
AT_hook 640 652 2.38e0 SMART
AT_hook 661 673 1.65e0 SMART
low complexity region 698 711 N/A INTRINSIC
coiled coil region 737 777 N/A INTRINSIC
DDT 838 903 3.75e-18 SMART
Pfam:WHIM1 940 989 4.8e-8 PFAM
low complexity region 1002 1014 N/A INTRINSIC
AT_hook 1175 1187 6.23e1 SMART
AT_hook 1389 1401 4.21e0 SMART
Pfam:WHIM3 1424 1462 5.5e-19 PFAM
PHD 1663 1709 1.47e-11 SMART
low complexity region 1742 1754 N/A INTRINSIC
BROMO 1774 1882 7.71e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217851
AA Change: S347R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218772
Predicted Effect probably benign
Transcript: ENSMUST00000219072
AA Change: S344R

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219980
Predicted Effect possibly damaging
Transcript: ENSMUST00000220049
AA Change: S344R

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (99/100)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Adgrf3 G A 5: 30,199,491 H316Y possibly damaging Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ak5 T A 3: 152,660,637 L42F probably damaging Het
Alas1 T C 9: 106,241,290 E211G probably damaging Het
Alkbh1 C T 12: 87,443,750 probably benign Het
Als2cl T C 9: 110,885,438 V118A probably benign Het
Ano1 G C 7: 144,611,390 L641V probably damaging Het
Arfgef1 C T 1: 10,188,752 probably null Het
Atf6b A T 17: 34,648,575 probably null Het
Atf7ip T G 6: 136,609,348 probably benign Het
Atp2b4 G T 1: 133,726,537 Q777K probably benign Het
C2cd3 T C 7: 100,455,493 probably benign Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Cdh12 T A 15: 21,583,740 N555K probably benign Het
Cenpj G A 14: 56,563,955 P187L possibly damaging Het
Cep112 T A 11: 108,519,261 probably null Het
Cfap54 A T 10: 92,942,979 probably benign Het
Cgref1 T G 5: 30,933,645 D275A possibly damaging Het
Clgn A C 8: 83,399,978 N103H probably benign Het
Corin A G 5: 72,316,051 V905A possibly damaging Het
Csta1 A C 16: 36,122,322 D72E probably benign Het
Cul5 A T 9: 53,667,156 L44Q probably damaging Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Dync1i2 G A 2: 71,249,853 probably null Het
Enoph1 A G 5: 100,059,219 D55G probably damaging Het
Fam160b2 A G 14: 70,585,049 V744A possibly damaging Het
Fat4 T A 3: 38,891,170 M1404K possibly damaging Het
Foxi2 G T 7: 135,410,677 G98V probably damaging Het
Galr2 T C 11: 116,282,939 S132P probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gm15446 C T 5: 109,942,496 H205Y probably damaging Het
Gm21775 T A Y: 10,553,910 I153N probably benign Het
Grip1 A G 10: 120,038,698 K789R possibly damaging Het
Gsk3b T A 16: 38,187,909 D192E probably benign Het
Herc2 T A 7: 56,163,897 H2625Q probably damaging Het
Hoxc9 A G 15: 102,984,123 D256G probably benign Het
Il7 A T 3: 7,573,915 N130K probably damaging Het
Irf2 A T 8: 46,807,345 N104I probably damaging Het
Kat6a A G 8: 22,939,305 N1559D possibly damaging Het
Kcnq4 G T 4: 120,698,002 F661L probably benign Het
Kdm5b T A 1: 134,613,214 D681E probably benign Het
Khdrbs1 T C 4: 129,725,721 E209G probably damaging Het
Lama3 A T 18: 12,528,333 R2116S probably damaging Het
Mir124-2hg C A 3: 17,785,713 E65* probably null Het
Mphosph10 T A 7: 64,376,751 L650F probably damaging Het
Mrpl48 T C 7: 100,549,333 E204G probably damaging Het
Msl3l2 T A 10: 56,115,944 L255Q probably damaging Het
Mx1 T A 16: 97,454,179 K225* probably null Het
Nf1 T C 11: 79,556,723 V435A probably damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Nop2 T A 6: 125,139,860 M359K probably null Het
Nox1 T C X: 134,095,244 probably benign Het
Ogdhl G A 14: 32,332,884 R263K probably damaging Het
Olfr1388 T A 11: 49,444,451 V200E probably damaging Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Pbsn T C X: 77,847,976 K72E probably damaging Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Ppt2 A T 17: 34,622,844 probably benign Het
Prl3a1 A G 13: 27,270,144 D35G probably benign Het
Ptprk T A 10: 28,566,603 I893N probably damaging Het
Ptprz1 T C 6: 22,986,323 probably benign Het
Rab3c A G 13: 110,260,516 V72A probably damaging Het
Rbms2 A G 10: 128,137,518 S251P probably benign Het
Rfwd3 A G 8: 111,297,495 V65A probably benign Het
Rps6kl1 T A 12: 85,139,623 Y211F probably benign Het
Saal1 T C 7: 46,699,456 Q317R probably damaging Het
Scg3 T C 9: 75,665,716 D311G probably damaging Het
Sdk2 C A 11: 113,854,332 M712I probably damaging Het
Serinc2 T G 4: 130,260,785 Y158S probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sgpp2 T A 1: 78,416,951 L197Q probably damaging Het
Shroom3 A T 5: 92,683,784 T40S probably damaging Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc7a3 A G X: 101,080,767 V464A probably benign Het
Snd1 T C 6: 28,745,207 F517S probably damaging Het
Spata13 A C 14: 60,759,591 I1165L possibly damaging Het
St8sia5 A T 18: 77,254,763 I390F probably damaging Het
Stat5b A T 11: 100,787,332 S652T probably benign Het
Stom A G 2: 35,316,025 S231P probably damaging Het
Sult1b1 A G 5: 87,535,033 Y18H probably damaging Het
Tgm4 T C 9: 123,061,770 I54T probably damaging Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tmem87a A T 2: 120,369,292 I457N probably damaging Het
Trim12c A G 7: 104,348,191 F53L possibly damaging Het
Ttc6 T A 12: 57,737,693 D1849E probably benign Het
Ubap2l A T 3: 90,031,376 probably benign Het
Ush2a T G 1: 188,381,549 probably null Het
Usp17la A C 7: 104,861,171 T328P probably damaging Het
Ust A G 10: 8,207,566 Y349H probably damaging Het
V1rd19 A T 7: 24,003,834 M242L probably benign Het
Vmn1r33 T A 6: 66,612,202 M123L probably benign Het
Vps13c A T 9: 67,860,833 K111N probably damaging Het
Vwa3a A G 7: 120,758,949 D81G probably damaging Het
Zfp318 G A 17: 46,397,024 R336Q probably damaging Het
Zfp609 A G 9: 65,704,434 S416P possibly damaging Het
Other mutations in Baz2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Baz2a APN 10 128124935 missense probably benign 0.00
IGL00501:Baz2a APN 10 128114625 missense probably benign 0.14
IGL00743:Baz2a APN 10 128114526 missense probably benign
IGL01362:Baz2a APN 10 128121964 missense probably damaging 0.98
IGL01394:Baz2a APN 10 128118645 missense possibly damaging 0.46
IGL01603:Baz2a APN 10 128111168 missense probably damaging 0.98
IGL02165:Baz2a APN 10 128119349 missense probably benign 0.03
IGL02732:Baz2a APN 10 128125175 missense possibly damaging 0.66
IGL03030:Baz2a APN 10 128125146 missense possibly damaging 0.62
IGL03087:Baz2a APN 10 128122313 missense probably damaging 0.99
R0255:Baz2a UTSW 10 128114639 missense possibly damaging 0.66
R0737:Baz2a UTSW 10 128116080 missense possibly damaging 0.92
R0742:Baz2a UTSW 10 128113666 nonsense probably null
R0755:Baz2a UTSW 10 128119691 missense possibly damaging 0.92
R0798:Baz2a UTSW 10 128126323 splice site probably benign
R0879:Baz2a UTSW 10 128121304 missense probably damaging 0.99
R1023:Baz2a UTSW 10 128121807 missense possibly damaging 0.66
R1482:Baz2a UTSW 10 128109008 missense possibly damaging 0.92
R1512:Baz2a UTSW 10 128124152 missense possibly damaging 0.95
R1658:Baz2a UTSW 10 128124383 missense probably benign 0.04
R1983:Baz2a UTSW 10 128123959 missense probably benign 0.14
R2141:Baz2a UTSW 10 128123612 missense probably damaging 1.00
R2921:Baz2a UTSW 10 128125077 frame shift probably null
R2922:Baz2a UTSW 10 128125077 frame shift probably null
R3104:Baz2a UTSW 10 128125077 frame shift probably null
R3105:Baz2a UTSW 10 128125077 frame shift probably null
R3106:Baz2a UTSW 10 128125077 frame shift probably null
R3621:Baz2a UTSW 10 128125077 frame shift probably null
R3872:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3873:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3875:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R4600:Baz2a UTSW 10 128121183 missense probably damaging 0.97
R4692:Baz2a UTSW 10 128124893 missense probably damaging 1.00
R4717:Baz2a UTSW 10 128124942 missense possibly damaging 0.83
R4821:Baz2a UTSW 10 128111109 missense probably damaging 1.00
R4832:Baz2a UTSW 10 128123130 missense probably benign 0.08
R4893:Baz2a UTSW 10 128123415 missense possibly damaging 0.66
R4907:Baz2a UTSW 10 128110808 missense probably damaging 0.99
R5133:Baz2a UTSW 10 128116126 missense probably damaging 1.00
R5340:Baz2a UTSW 10 128115042 missense probably damaging 1.00
R5527:Baz2a UTSW 10 128124917 missense probably damaging 1.00
R5761:Baz2a UTSW 10 128119690 missense possibly damaging 0.66
R5891:Baz2a UTSW 10 128121322 missense probably damaging 1.00
R6088:Baz2a UTSW 10 128114642 small deletion probably benign
R6089:Baz2a UTSW 10 128114642 small deletion probably benign
R6323:Baz2a UTSW 10 128126417 missense probably benign 0.21
R6894:Baz2a UTSW 10 128123581 missense possibly damaging 0.81
R7101:Baz2a UTSW 10 128121187 missense possibly damaging 0.66
R7178:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7179:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7202:Baz2a UTSW 10 128118559 missense possibly damaging 0.54
R7223:Baz2a UTSW 10 128112606 missense probably damaging 1.00
R7268:Baz2a UTSW 10 128124221 missense possibly damaging 0.66
R7426:Baz2a UTSW 10 128116078 missense probably damaging 1.00
R7464:Baz2a UTSW 10 128122073 missense possibly damaging 0.81
R7568:Baz2a UTSW 10 128125270 missense possibly damaging 0.83
R7672:Baz2a UTSW 10 128123857 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGGCCTTAGGAAAATCTGACTTTC -3'
(R):5'- AAGGTACAGCTTCATACTTCCCAG -3'

Sequencing Primer
(F):5'- TAGATGATGCGGAGCTGA -3'
(R):5'- ACAGCTTCATACTTCCCAGTTTAAGG -3'
Posted On2014-09-17