Incidental Mutation 'R2059:Sdk2'
ID 228497
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Name sidekick cell adhesion molecule 2
Synonyms 4632412F08Rik, 5330435L01Rik
MMRRC Submission 040064-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R2059 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 113667200-113957855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 113745158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 712 (M712I)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627] [ENSMUST00000141943]
AlphaFold Q6V4S5
Predicted Effect probably damaging
Transcript: ENSMUST00000041627
AA Change: M712I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: M712I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141943
AA Change: M712I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116872
Gene: ENSMUSG00000041592
AA Change: M712I

DomainStartEndE-ValueType
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 889 1.96e1 SMART
Meta Mutation Damage Score 0.2188 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 G A 5: 30,404,489 (GRCm39) H316Y possibly damaging Het
Adgrf5 A G 17: 43,739,477 (GRCm39) Y72C possibly damaging Het
Ak5 T A 3: 152,366,274 (GRCm39) L42F probably damaging Het
Alas1 T C 9: 106,118,489 (GRCm39) E211G probably damaging Het
Alkbh1 C T 12: 87,490,520 (GRCm39) probably benign Het
Als2cl T C 9: 110,714,506 (GRCm39) V118A probably benign Het
Ano1 G C 7: 144,165,127 (GRCm39) L641V probably damaging Het
Arfgef1 C T 1: 10,258,977 (GRCm39) probably null Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Atf7ip T G 6: 136,586,346 (GRCm39) probably benign Het
Atp2b4 G T 1: 133,654,275 (GRCm39) Q777K probably benign Het
Baz2a T A 10: 127,949,447 (GRCm39) S347R probably damaging Het
C2cd3 T C 7: 100,104,700 (GRCm39) probably benign Het
Cage1 A G 13: 38,207,356 (GRCm39) V163A probably benign Het
Cdh12 T A 15: 21,583,826 (GRCm39) N555K probably benign Het
Cenpj G A 14: 56,801,412 (GRCm39) P187L possibly damaging Het
Cep112 T A 11: 108,410,087 (GRCm39) probably null Het
Cfap54 A T 10: 92,778,841 (GRCm39) probably benign Het
Cgref1 T G 5: 31,090,989 (GRCm39) D275A possibly damaging Het
Clgn A C 8: 84,126,607 (GRCm39) N103H probably benign Het
Corin A G 5: 72,473,394 (GRCm39) V905A possibly damaging Het
Csta1 A C 16: 35,942,692 (GRCm39) D72E probably benign Het
Cul5 A T 9: 53,578,456 (GRCm39) L44Q probably damaging Het
Dmbt1 G A 7: 130,707,900 (GRCm39) A1381T possibly damaging Het
Dync1i2 G A 2: 71,080,197 (GRCm39) probably null Het
Enoph1 A G 5: 100,207,078 (GRCm39) D55G probably damaging Het
Fat4 T A 3: 38,945,319 (GRCm39) M1404K possibly damaging Het
Fhip2b A G 14: 70,822,489 (GRCm39) V744A possibly damaging Het
Foxi2 G T 7: 135,012,406 (GRCm39) G98V probably damaging Het
Galr2 T C 11: 116,173,765 (GRCm39) S132P probably damaging Het
Gcm2 T C 13: 41,263,430 (GRCm39) M1V probably null Het
Gm15446 C T 5: 110,090,362 (GRCm39) H205Y probably damaging Het
Gm21775 T A Y: 10,553,910 (GRCm39) I153N probably benign Het
Grip1 A G 10: 119,874,603 (GRCm39) K789R possibly damaging Het
Gsk3b T A 16: 38,008,271 (GRCm39) D192E probably benign Het
Herc2 T A 7: 55,813,645 (GRCm39) H2625Q probably damaging Het
Hoxc9 A G 15: 102,892,555 (GRCm39) D256G probably benign Het
Il7 A T 3: 7,638,975 (GRCm39) N130K probably damaging Het
Irf2 A T 8: 47,260,380 (GRCm39) N104I probably damaging Het
Kat6a A G 8: 23,429,321 (GRCm39) N1559D possibly damaging Het
Kcnq4 G T 4: 120,555,199 (GRCm39) F661L probably benign Het
Kdm5b T A 1: 134,540,952 (GRCm39) D681E probably benign Het
Khdrbs1 T C 4: 129,619,514 (GRCm39) E209G probably damaging Het
Lama3 A T 18: 12,661,390 (GRCm39) R2116S probably damaging Het
Mir124-2hg C A 3: 17,839,877 (GRCm39) E65* probably null Het
Mphosph10 T A 7: 64,026,499 (GRCm39) L650F probably damaging Het
Mrpl48 T C 7: 100,198,540 (GRCm39) E204G probably damaging Het
Msl3l2 T A 10: 55,992,040 (GRCm39) L255Q probably damaging Het
Mx1 T A 16: 97,255,379 (GRCm39) K225* probably null Het
Nf1 T C 11: 79,447,549 (GRCm39) V435A probably damaging Het
Nid1 A C 13: 13,675,058 (GRCm39) H926P probably benign Het
Nlrp9a T A 7: 26,256,787 (GRCm39) I46K possibly damaging Het
Nop2 T A 6: 125,116,823 (GRCm39) M359K probably null Het
Nox1 T C X: 132,995,993 (GRCm39) probably benign Het
Ogdhl G A 14: 32,054,841 (GRCm39) R263K probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or2y16 T A 11: 49,335,278 (GRCm39) V200E probably damaging Het
Pbsn T C X: 76,891,582 (GRCm39) K72E probably damaging Het
Pde12 T C 14: 26,390,035 (GRCm39) I225V probably benign Het
Ppt2 A T 17: 34,841,818 (GRCm39) probably benign Het
Prl3a1 A G 13: 27,454,127 (GRCm39) D35G probably benign Het
Prss3b G A 6: 41,009,315 (GRCm39) T173I probably benign Het
Ptprk T A 10: 28,442,599 (GRCm39) I893N probably damaging Het
Ptprz1 T C 6: 22,986,322 (GRCm39) probably benign Het
Rab3c A G 13: 110,397,050 (GRCm39) V72A probably damaging Het
Rbms2 A G 10: 127,973,387 (GRCm39) S251P probably benign Het
Rfwd3 A G 8: 112,024,127 (GRCm39) V65A probably benign Het
Rps6kl1 T A 12: 85,186,397 (GRCm39) Y211F probably benign Het
Saal1 T C 7: 46,348,880 (GRCm39) Q317R probably damaging Het
Scg3 T C 9: 75,572,998 (GRCm39) D311G probably damaging Het
Serinc2 T G 4: 130,154,578 (GRCm39) Y158S probably damaging Het
Serpinb9c A T 13: 33,340,854 (GRCm39) C81* probably null Het
Sgpp2 T A 1: 78,393,588 (GRCm39) L197Q probably damaging Het
Shroom3 A T 5: 92,831,643 (GRCm39) T40S probably damaging Het
Sik1 A G 17: 32,067,771 (GRCm39) S435P probably benign Het
Slc7a3 A G X: 100,124,373 (GRCm39) V464A probably benign Het
Snd1 T C 6: 28,745,206 (GRCm39) F517S probably damaging Het
Spata13 A C 14: 60,997,040 (GRCm39) I1165L possibly damaging Het
St8sia5 A T 18: 77,342,459 (GRCm39) I390F probably damaging Het
Stat5b A T 11: 100,678,158 (GRCm39) S652T probably benign Het
Stom A G 2: 35,206,037 (GRCm39) S231P probably damaging Het
Sult1b1 A G 5: 87,682,892 (GRCm39) Y18H probably damaging Het
Tgm4 T C 9: 122,890,835 (GRCm39) I54T probably damaging Het
Tmem176b G A 6: 48,813,267 (GRCm39) T64I probably damaging Het
Tmem87a A T 2: 120,199,773 (GRCm39) I457N probably damaging Het
Trim12c A G 7: 103,997,398 (GRCm39) F53L possibly damaging Het
Ttc6 T A 12: 57,784,479 (GRCm39) D1849E probably benign Het
Ubap2l A T 3: 89,938,683 (GRCm39) probably benign Het
Ush2a T G 1: 188,113,746 (GRCm39) probably null Het
Usp17la A C 7: 104,510,378 (GRCm39) T328P probably damaging Het
Ust A G 10: 8,083,330 (GRCm39) Y349H probably damaging Het
V1rd19 A T 7: 23,703,259 (GRCm39) M242L probably benign Het
Vmn1r33 T A 6: 66,589,186 (GRCm39) M123L probably benign Het
Vps13c A T 9: 67,768,115 (GRCm39) K111N probably damaging Het
Vwa3a A G 7: 120,358,172 (GRCm39) D81G probably damaging Het
Zfp318 G A 17: 46,707,950 (GRCm39) R336Q probably damaging Het
Zfp609 A G 9: 65,611,716 (GRCm39) S416P possibly damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113,745,210 (GRCm39) missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113,721,668 (GRCm39) missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113,733,906 (GRCm39) missense probably benign
IGL01316:Sdk2 APN 11 113,758,791 (GRCm39) missense probably benign 0.09
IGL01614:Sdk2 APN 11 113,684,684 (GRCm39) missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113,729,358 (GRCm39) missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113,729,320 (GRCm39) missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113,725,656 (GRCm39) missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113,725,639 (GRCm39) splice site probably benign
IGL02543:Sdk2 APN 11 113,759,747 (GRCm39) missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113,742,668 (GRCm39) missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113,712,452 (GRCm39) missense probably benign 0.00
IGL03122:Sdk2 APN 11 113,732,894 (GRCm39) missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113,741,810 (GRCm39) missense probably benign 0.19
IGL03222:Sdk2 APN 11 113,729,257 (GRCm39) missense probably benign 0.01
IGL03310:Sdk2 APN 11 113,684,151 (GRCm39) missense possibly damaging 0.77
Curtailed UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
Trimmed UTSW 11 113,747,522 (GRCm39) nonsense probably null
ANU05:Sdk2 UTSW 11 113,733,906 (GRCm39) missense probably benign
BB008:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113,717,912 (GRCm39) missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0386:Sdk2 UTSW 11 113,784,290 (GRCm39) missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113,720,793 (GRCm39) missense probably benign 0.04
R0409:Sdk2 UTSW 11 113,741,717 (GRCm39) splice site probably benign
R0416:Sdk2 UTSW 11 113,694,029 (GRCm39) missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113,682,292 (GRCm39) missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113,671,836 (GRCm39) missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113,685,746 (GRCm39) splice site probably null
R0711:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0717:Sdk2 UTSW 11 113,723,152 (GRCm39) missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R0831:Sdk2 UTSW 11 113,723,084 (GRCm39) missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113,712,241 (GRCm39) missense probably benign 0.00
R0865:Sdk2 UTSW 11 113,741,748 (GRCm39) missense probably benign 0.12
R0930:Sdk2 UTSW 11 113,729,271 (GRCm39) missense probably benign 0.01
R0964:Sdk2 UTSW 11 113,697,243 (GRCm39) splice site probably benign
R1051:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1052:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1054:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1055:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1077:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1079:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1115:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1186:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1187:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1337:Sdk2 UTSW 11 113,723,157 (GRCm39) missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1433:Sdk2 UTSW 11 113,685,871 (GRCm39) missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113,784,401 (GRCm39) splice site probably benign
R1514:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1529:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1596:Sdk2 UTSW 11 113,729,435 (GRCm39) splice site probably benign
R1680:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1680:Sdk2 UTSW 11 113,682,262 (GRCm39) missense possibly damaging 0.47
R1770:Sdk2 UTSW 11 113,684,567 (GRCm39) missense probably benign 0.05
R1858:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1866:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1874:Sdk2 UTSW 11 113,725,782 (GRCm39) missense probably benign 0.00
R1899:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1905:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1907:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1913:Sdk2 UTSW 11 113,747,552 (GRCm39) missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113,671,843 (GRCm39) nonsense probably null
R2055:Sdk2 UTSW 11 113,741,780 (GRCm39) missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113,833,948 (GRCm39) missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113,721,620 (GRCm39) missense probably benign 0.44
R3720:Sdk2 UTSW 11 113,691,070 (GRCm39) missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113,747,522 (GRCm39) nonsense probably null
R4037:Sdk2 UTSW 11 113,685,881 (GRCm39) missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113,757,815 (GRCm39) splice site probably null
R4717:Sdk2 UTSW 11 113,745,195 (GRCm39) missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113,717,880 (GRCm39) missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113,712,208 (GRCm39) nonsense probably null
R4924:Sdk2 UTSW 11 113,748,584 (GRCm39) missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113,684,587 (GRCm39) missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113,741,808 (GRCm39) missense probably benign 0.01
R5239:Sdk2 UTSW 11 113,758,859 (GRCm39) missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113,715,912 (GRCm39) missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113,757,857 (GRCm39) missense probably benign 0.31
R5535:Sdk2 UTSW 11 113,833,984 (GRCm39) missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113,742,540 (GRCm39) missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113,724,005 (GRCm39) missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113,759,778 (GRCm39) missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113,717,942 (GRCm39) missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113,745,099 (GRCm39) missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113,725,810 (GRCm39) missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113,742,708 (GRCm39) missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113,720,885 (GRCm39) missense probably benign 0.00
R5953:Sdk2 UTSW 11 113,684,570 (GRCm39) missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113,834,080 (GRCm39) missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113,720,889 (GRCm39) missense probably benign 0.00
R6116:Sdk2 UTSW 11 113,745,190 (GRCm39) missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113,684,581 (GRCm39) missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R6383:Sdk2 UTSW 11 113,723,091 (GRCm39) missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113,758,760 (GRCm39) missense probably benign 0.43
R6835:Sdk2 UTSW 11 113,720,874 (GRCm39) missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113,671,755 (GRCm39) missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113,793,946 (GRCm39) missense probably benign 0.03
R7000:Sdk2 UTSW 11 113,693,995 (GRCm39) missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113,725,731 (GRCm39) missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113,733,516 (GRCm39) nonsense probably null
R7177:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113,729,315 (GRCm39) missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113,758,909 (GRCm39) splice site probably null
R7504:Sdk2 UTSW 11 113,758,793 (GRCm39) missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113,764,039 (GRCm39) missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113,684,563 (GRCm39) missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113,764,027 (GRCm39) missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113,750,764 (GRCm39) missense probably benign 0.18
R8052:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113,717,915 (GRCm39) missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113,742,539 (GRCm39) missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113,763,683 (GRCm39) missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113,729,542 (GRCm39) missense probably benign
R8715:Sdk2 UTSW 11 113,671,728 (GRCm39) missense probably damaging 1.00
R8774:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113,763,978 (GRCm39) nonsense probably null
R9136:Sdk2 UTSW 11 113,697,203 (GRCm39) missense probably damaging 1.00
R9147:Sdk2 UTSW 11 113,714,226 (GRCm39) missense probably benign 0.18
R9300:Sdk2 UTSW 11 113,715,856 (GRCm39) missense possibly damaging 0.63
R9354:Sdk2 UTSW 11 113,725,757 (GRCm39) missense probably benign 0.00
R9450:Sdk2 UTSW 11 113,697,105 (GRCm39) missense probably benign
R9462:Sdk2 UTSW 11 113,760,744 (GRCm39) missense possibly damaging 0.56
R9616:Sdk2 UTSW 11 113,691,061 (GRCm39) missense probably benign 0.05
R9678:Sdk2 UTSW 11 113,685,789 (GRCm39) nonsense probably null
RF002:Sdk2 UTSW 11 113,776,078 (GRCm39) missense probably benign 0.00
V1662:Sdk2 UTSW 11 113,725,734 (GRCm39) missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113,742,662 (GRCm39) missense probably damaging 0.97
Z1176:Sdk2 UTSW 11 113,730,148 (GRCm39) missense probably benign 0.41
Z1177:Sdk2 UTSW 11 113,750,782 (GRCm39) missense probably benign
Z1177:Sdk2 UTSW 11 113,730,146 (GRCm39) missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113,729,485 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCATTTTACCGTAGCCC -3'
(R):5'- CGCAATATGGTTAGCCCTTTG -3'

Sequencing Primer
(F):5'- GCAGTGTGGGCATTTCTCATCAC -3'
(R):5'- AGCCCTTTGTCATTTTATTATAGCC -3'
Posted On 2014-09-17