Incidental Mutation 'R2059:Rab3c'
ID 228508
Institutional Source Beutler Lab
Gene Symbol Rab3c
Ensembl Gene ENSMUSG00000021700
Gene Name RAB3C, member RAS oncogene family
Synonyms 3110015B08Rik, 3110037E15Rik, 2700062I01Rik
MMRRC Submission 040064-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2059 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 110190721-110417530 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110397050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000132945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167824] [ENSMUST00000223922] [ENSMUST00000224180]
AlphaFold P62823
Predicted Effect probably damaging
Transcript: ENSMUST00000167824
AA Change: V72A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132945
Gene: ENSMUSG00000021700
AA Change: V72A

DomainStartEndE-ValueType
RAB 31 194 1.35e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223922
AA Change: V70A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000224180
AA Change: V72A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224287
Meta Mutation Damage Score 0.2467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 G A 5: 30,404,489 (GRCm39) H316Y possibly damaging Het
Adgrf5 A G 17: 43,739,477 (GRCm39) Y72C possibly damaging Het
Ak5 T A 3: 152,366,274 (GRCm39) L42F probably damaging Het
Alas1 T C 9: 106,118,489 (GRCm39) E211G probably damaging Het
Alkbh1 C T 12: 87,490,520 (GRCm39) probably benign Het
Als2cl T C 9: 110,714,506 (GRCm39) V118A probably benign Het
Ano1 G C 7: 144,165,127 (GRCm39) L641V probably damaging Het
Arfgef1 C T 1: 10,258,977 (GRCm39) probably null Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Atf7ip T G 6: 136,586,346 (GRCm39) probably benign Het
Atp2b4 G T 1: 133,654,275 (GRCm39) Q777K probably benign Het
Baz2a T A 10: 127,949,447 (GRCm39) S347R probably damaging Het
C2cd3 T C 7: 100,104,700 (GRCm39) probably benign Het
Cage1 A G 13: 38,207,356 (GRCm39) V163A probably benign Het
Cdh12 T A 15: 21,583,826 (GRCm39) N555K probably benign Het
Cenpj G A 14: 56,801,412 (GRCm39) P187L possibly damaging Het
Cep112 T A 11: 108,410,087 (GRCm39) probably null Het
Cfap54 A T 10: 92,778,841 (GRCm39) probably benign Het
Cgref1 T G 5: 31,090,989 (GRCm39) D275A possibly damaging Het
Clgn A C 8: 84,126,607 (GRCm39) N103H probably benign Het
Corin A G 5: 72,473,394 (GRCm39) V905A possibly damaging Het
Csta1 A C 16: 35,942,692 (GRCm39) D72E probably benign Het
Cul5 A T 9: 53,578,456 (GRCm39) L44Q probably damaging Het
Dmbt1 G A 7: 130,707,900 (GRCm39) A1381T possibly damaging Het
Dync1i2 G A 2: 71,080,197 (GRCm39) probably null Het
Enoph1 A G 5: 100,207,078 (GRCm39) D55G probably damaging Het
Fat4 T A 3: 38,945,319 (GRCm39) M1404K possibly damaging Het
Fhip2b A G 14: 70,822,489 (GRCm39) V744A possibly damaging Het
Foxi2 G T 7: 135,012,406 (GRCm39) G98V probably damaging Het
Galr2 T C 11: 116,173,765 (GRCm39) S132P probably damaging Het
Gcm2 T C 13: 41,263,430 (GRCm39) M1V probably null Het
Gm15446 C T 5: 110,090,362 (GRCm39) H205Y probably damaging Het
Gm21775 T A Y: 10,553,910 (GRCm39) I153N probably benign Het
Grip1 A G 10: 119,874,603 (GRCm39) K789R possibly damaging Het
Gsk3b T A 16: 38,008,271 (GRCm39) D192E probably benign Het
Herc2 T A 7: 55,813,645 (GRCm39) H2625Q probably damaging Het
Hoxc9 A G 15: 102,892,555 (GRCm39) D256G probably benign Het
Il7 A T 3: 7,638,975 (GRCm39) N130K probably damaging Het
Irf2 A T 8: 47,260,380 (GRCm39) N104I probably damaging Het
Kat6a A G 8: 23,429,321 (GRCm39) N1559D possibly damaging Het
Kcnq4 G T 4: 120,555,199 (GRCm39) F661L probably benign Het
Kdm5b T A 1: 134,540,952 (GRCm39) D681E probably benign Het
Khdrbs1 T C 4: 129,619,514 (GRCm39) E209G probably damaging Het
Lama3 A T 18: 12,661,390 (GRCm39) R2116S probably damaging Het
Mir124-2hg C A 3: 17,839,877 (GRCm39) E65* probably null Het
Mphosph10 T A 7: 64,026,499 (GRCm39) L650F probably damaging Het
Mrpl48 T C 7: 100,198,540 (GRCm39) E204G probably damaging Het
Msl3l2 T A 10: 55,992,040 (GRCm39) L255Q probably damaging Het
Mx1 T A 16: 97,255,379 (GRCm39) K225* probably null Het
Nf1 T C 11: 79,447,549 (GRCm39) V435A probably damaging Het
Nid1 A C 13: 13,675,058 (GRCm39) H926P probably benign Het
Nlrp9a T A 7: 26,256,787 (GRCm39) I46K possibly damaging Het
Nop2 T A 6: 125,116,823 (GRCm39) M359K probably null Het
Nox1 T C X: 132,995,993 (GRCm39) probably benign Het
Ogdhl G A 14: 32,054,841 (GRCm39) R263K probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or2y16 T A 11: 49,335,278 (GRCm39) V200E probably damaging Het
Pbsn T C X: 76,891,582 (GRCm39) K72E probably damaging Het
Pde12 T C 14: 26,390,035 (GRCm39) I225V probably benign Het
Ppt2 A T 17: 34,841,818 (GRCm39) probably benign Het
Prl3a1 A G 13: 27,454,127 (GRCm39) D35G probably benign Het
Prss3b G A 6: 41,009,315 (GRCm39) T173I probably benign Het
Ptprk T A 10: 28,442,599 (GRCm39) I893N probably damaging Het
Ptprz1 T C 6: 22,986,322 (GRCm39) probably benign Het
Rbms2 A G 10: 127,973,387 (GRCm39) S251P probably benign Het
Rfwd3 A G 8: 112,024,127 (GRCm39) V65A probably benign Het
Rps6kl1 T A 12: 85,186,397 (GRCm39) Y211F probably benign Het
Saal1 T C 7: 46,348,880 (GRCm39) Q317R probably damaging Het
Scg3 T C 9: 75,572,998 (GRCm39) D311G probably damaging Het
Sdk2 C A 11: 113,745,158 (GRCm39) M712I probably damaging Het
Serinc2 T G 4: 130,154,578 (GRCm39) Y158S probably damaging Het
Serpinb9c A T 13: 33,340,854 (GRCm39) C81* probably null Het
Sgpp2 T A 1: 78,393,588 (GRCm39) L197Q probably damaging Het
Shroom3 A T 5: 92,831,643 (GRCm39) T40S probably damaging Het
Sik1 A G 17: 32,067,771 (GRCm39) S435P probably benign Het
Slc7a3 A G X: 100,124,373 (GRCm39) V464A probably benign Het
Snd1 T C 6: 28,745,206 (GRCm39) F517S probably damaging Het
Spata13 A C 14: 60,997,040 (GRCm39) I1165L possibly damaging Het
St8sia5 A T 18: 77,342,459 (GRCm39) I390F probably damaging Het
Stat5b A T 11: 100,678,158 (GRCm39) S652T probably benign Het
Stom A G 2: 35,206,037 (GRCm39) S231P probably damaging Het
Sult1b1 A G 5: 87,682,892 (GRCm39) Y18H probably damaging Het
Tgm4 T C 9: 122,890,835 (GRCm39) I54T probably damaging Het
Tmem176b G A 6: 48,813,267 (GRCm39) T64I probably damaging Het
Tmem87a A T 2: 120,199,773 (GRCm39) I457N probably damaging Het
Trim12c A G 7: 103,997,398 (GRCm39) F53L possibly damaging Het
Ttc6 T A 12: 57,784,479 (GRCm39) D1849E probably benign Het
Ubap2l A T 3: 89,938,683 (GRCm39) probably benign Het
Ush2a T G 1: 188,113,746 (GRCm39) probably null Het
Usp17la A C 7: 104,510,378 (GRCm39) T328P probably damaging Het
Ust A G 10: 8,083,330 (GRCm39) Y349H probably damaging Het
V1rd19 A T 7: 23,703,259 (GRCm39) M242L probably benign Het
Vmn1r33 T A 6: 66,589,186 (GRCm39) M123L probably benign Het
Vps13c A T 9: 67,768,115 (GRCm39) K111N probably damaging Het
Vwa3a A G 7: 120,358,172 (GRCm39) D81G probably damaging Het
Zfp318 G A 17: 46,707,950 (GRCm39) R336Q probably damaging Het
Zfp609 A G 9: 65,611,716 (GRCm39) S416P possibly damaging Het
Other mutations in Rab3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1294:Rab3c UTSW 13 110,397,099 (GRCm39) missense possibly damaging 0.72
R1346:Rab3c UTSW 13 110,397,120 (GRCm39) missense probably damaging 1.00
R1819:Rab3c UTSW 13 110,220,669 (GRCm39) missense possibly damaging 0.52
R1903:Rab3c UTSW 13 110,220,744 (GRCm39) missense probably damaging 1.00
R4018:Rab3c UTSW 13 110,220,728 (GRCm39) missense probably damaging 1.00
R4707:Rab3c UTSW 13 110,198,434 (GRCm39) missense probably benign 0.00
R4784:Rab3c UTSW 13 110,198,434 (GRCm39) missense probably benign 0.00
R4785:Rab3c UTSW 13 110,198,434 (GRCm39) missense probably benign 0.00
R5305:Rab3c UTSW 13 110,317,611 (GRCm39) missense probably damaging 1.00
R5358:Rab3c UTSW 13 110,198,497 (GRCm39) missense possibly damaging 0.77
R8136:Rab3c UTSW 13 110,317,554 (GRCm39) nonsense probably null
R8739:Rab3c UTSW 13 110,397,135 (GRCm39) missense probably damaging 0.98
Z1177:Rab3c UTSW 13 110,397,020 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGTACCCACATCTTCAAAAG -3'
(R):5'- ACAAGATGCCAGGTTTGGTC -3'

Sequencing Primer
(F):5'- TCTGAAACACAATGTTCTCCAGC -3'
(R):5'- CCAGGTTTGGTCAGAAAGACTCTTC -3'
Posted On 2014-09-17