Mutagenetix > Incidental Mutation

Incidental Mutation 'R2059:Rab3c'

228508

Institutional Source

Beutler Lab

Gene Symbol

Rab3c

Ensembl Gene

ENSMUSG00000021700

Gene Name

RAB3C, member RAS oncogene family

Synonyms

MMRRC Submission

040064-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2059 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110054187-110280996 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110260516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 72 (V72A)

Ref Sequence

ENSEMBL: ENSMUSP00000132945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167824] [ENSMUST00000223922] [ENSMUST00000224180]

AlphaFold

P62823

Predicted Effect

probably damaging
Transcript: ENSMUST00000167824
AA Change: V72A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000132945
Gene: ENSMUSG00000021700
AA Change: V72A

Domain	Start	End	E-Value	Type
RAB	31	194	1.35e-93	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000223922
AA Change: V70A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224180
AA Change: V72A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224287

Meta Mutation Damage Score

0.2467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	G	A	6: 41,032,381	T173I	probably benign	Het
Adgrf3	G	A	5: 30,199,491	H316Y	possibly damaging	Het
Adgrf5	A	G	17: 43,428,586	Y72C	possibly damaging	Het
Ak5	T	A	3: 152,660,637	L42F	probably damaging	Het
Alas1	T	C	9: 106,241,290	E211G	probably damaging	Het
Alkbh1	C	T	12: 87,443,750		probably benign	Het
Als2cl	T	C	9: 110,885,438	V118A	probably benign	Het
Ano1	G	C	7: 144,611,390	L641V	probably damaging	Het
Arfgef1	C	T	1: 10,188,752		probably null	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Atf7ip	T	G	6: 136,609,348		probably benign	Het
Atp2b4	G	T	1: 133,726,537	Q777K	probably benign	Het
Baz2a	T	A	10: 128,113,578	S347R	probably damaging	Het
C2cd3	T	C	7: 100,455,493		probably benign	Het
Cage1	A	G	13: 38,023,380	V163A	probably benign	Het
Cdh12	T	A	15: 21,583,740	N555K	probably benign	Het
Cenpj	G	A	14: 56,563,955	P187L	possibly damaging	Het
Cep112	T	A	11: 108,519,261		probably null	Het
Cfap54	A	T	10: 92,942,979		probably benign	Het
Cgref1	T	G	5: 30,933,645	D275A	possibly damaging	Het
Clgn	A	C	8: 83,399,978	N103H	probably benign	Het
Corin	A	G	5: 72,316,051	V905A	possibly damaging	Het
Csta1	A	C	16: 36,122,322	D72E	probably benign	Het
Cul5	A	T	9: 53,667,156	L44Q	probably damaging	Het
Dmbt1	G	A	7: 131,106,170	A1381T	possibly damaging	Het
Dync1i2	G	A	2: 71,249,853		probably null	Het
Enoph1	A	G	5: 100,059,219	D55G	probably damaging	Het
Fam160b2	A	G	14: 70,585,049	V744A	possibly damaging	Het
Fat4	T	A	3: 38,891,170	M1404K	possibly damaging	Het
Foxi2	G	T	7: 135,410,677	G98V	probably damaging	Het
Galr2	T	C	11: 116,282,939	S132P	probably damaging	Het
Gcm2	T	C	13: 41,109,954	M1V	probably null	Het
Gm15446	C	T	5: 109,942,496	H205Y	probably damaging	Het
Gm21775	T	A	Y: 10,553,910	I153N	probably benign	Het
Grip1	A	G	10: 120,038,698	K789R	possibly damaging	Het
Gsk3b	T	A	16: 38,187,909	D192E	probably benign	Het
Herc2	T	A	7: 56,163,897	H2625Q	probably damaging	Het
Hoxc9	A	G	15: 102,984,123	D256G	probably benign	Het
Il7	A	T	3: 7,573,915	N130K	probably damaging	Het
Irf2	A	T	8: 46,807,345	N104I	probably damaging	Het
Kat6a	A	G	8: 22,939,305	N1559D	possibly damaging	Het
Kcnq4	G	T	4: 120,698,002	F661L	probably benign	Het
Kdm5b	T	A	1: 134,613,214	D681E	probably benign	Het
Khdrbs1	T	C	4: 129,725,721	E209G	probably damaging	Het
Lama3	A	T	18: 12,528,333	R2116S	probably damaging	Het
Mir124-2hg	C	A	3: 17,785,713	E65*	probably null	Het
Mphosph10	T	A	7: 64,376,751	L650F	probably damaging	Het
Mrpl48	T	C	7: 100,549,333	E204G	probably damaging	Het
Msl3l2	T	A	10: 56,115,944	L255Q	probably damaging	Het
Mx1	T	A	16: 97,454,179	K225*	probably null	Het
Nf1	T	C	11: 79,556,723	V435A	probably damaging	Het
Nid1	A	C	13: 13,500,473	H926P	probably benign	Het
Nlrp9a	T	A	7: 26,557,362	I46K	possibly damaging	Het
Nop2	T	A	6: 125,139,860	M359K	probably null	Het
Nox1	T	C	X: 134,095,244		probably benign	Het
Ogdhl	G	A	14: 32,332,884	R263K	probably damaging	Het
Olfr1388	T	A	11: 49,444,451	V200E	probably damaging	Het
Olfr293	A	T	7: 86,664,383	K240N	probably damaging	Het
Pbsn	T	C	X: 77,847,976	K72E	probably damaging	Het
Pde12	T	C	14: 26,668,880	I225V	probably benign	Het
Ppt2	A	T	17: 34,622,844		probably benign	Het
Prl3a1	A	G	13: 27,270,144	D35G	probably benign	Het
Ptprk	T	A	10: 28,566,603	I893N	probably damaging	Het
Ptprz1	T	C	6: 22,986,323		probably benign	Het
Rbms2	A	G	10: 128,137,518	S251P	probably benign	Het
Rfwd3	A	G	8: 111,297,495	V65A	probably benign	Het
Rps6kl1	T	A	12: 85,139,623	Y211F	probably benign	Het
Saal1	T	C	7: 46,699,456	Q317R	probably damaging	Het
Scg3	T	C	9: 75,665,716	D311G	probably damaging	Het
Sdk2	C	A	11: 113,854,332	M712I	probably damaging	Het
Serinc2	T	G	4: 130,260,785	Y158S	probably damaging	Het
Serpinb9c	A	T	13: 33,156,871	C81*	probably null	Het
Sgpp2	T	A	1: 78,416,951	L197Q	probably damaging	Het
Shroom3	A	T	5: 92,683,784	T40S	probably damaging	Het
Sik1	A	G	17: 31,848,797	S435P	probably benign	Het
Slc7a3	A	G	X: 101,080,767	V464A	probably benign	Het
Snd1	T	C	6: 28,745,207	F517S	probably damaging	Het
Spata13	A	C	14: 60,759,591	I1165L	possibly damaging	Het
St8sia5	A	T	18: 77,254,763	I390F	probably damaging	Het
Stat5b	A	T	11: 100,787,332	S652T	probably benign	Het
Stom	A	G	2: 35,316,025	S231P	probably damaging	Het
Sult1b1	A	G	5: 87,535,033	Y18H	probably damaging	Het
Tgm4	T	C	9: 123,061,770	I54T	probably damaging	Het
Tmem176b	G	A	6: 48,836,333	T64I	probably damaging	Het
Tmem87a	A	T	2: 120,369,292	I457N	probably damaging	Het
Trim12c	A	G	7: 104,348,191	F53L	possibly damaging	Het
Ttc6	T	A	12: 57,737,693	D1849E	probably benign	Het
Ubap2l	A	T	3: 90,031,376		probably benign	Het
Ush2a	T	G	1: 188,381,549		probably null	Het
Usp17la	A	C	7: 104,861,171	T328P	probably damaging	Het
Ust	A	G	10: 8,207,566	Y349H	probably damaging	Het
V1rd19	A	T	7: 24,003,834	M242L	probably benign	Het
Vmn1r33	T	A	6: 66,612,202	M123L	probably benign	Het
Vps13c	A	T	9: 67,860,833	K111N	probably damaging	Het
Vwa3a	A	G	7: 120,758,949	D81G	probably damaging	Het
Zfp318	G	A	17: 46,397,024	R336Q	probably damaging	Het
Zfp609	A	G	9: 65,704,434	S416P	possibly damaging	Het

Other mutations in Rab3c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1294:Rab3c	UTSW	13	110260565	missense	possibly damaging	0.72
R1346:Rab3c	UTSW	13	110260586	missense	probably damaging	1.00
R1819:Rab3c	UTSW	13	110084135	missense	possibly damaging	0.52
R1903:Rab3c	UTSW	13	110084210	missense	probably damaging	1.00
R4018:Rab3c	UTSW	13	110084194	missense	probably damaging	1.00
R4707:Rab3c	UTSW	13	110061900	missense	probably benign	0.00
R4784:Rab3c	UTSW	13	110061900	missense	probably benign	0.00
R4785:Rab3c	UTSW	13	110061900	missense	probably benign	0.00
R5305:Rab3c	UTSW	13	110181077	missense	probably damaging	1.00
R5358:Rab3c	UTSW	13	110061963	missense	possibly damaging	0.77
R8136:Rab3c	UTSW	13	110181020	nonsense	probably null
R8739:Rab3c	UTSW	13	110260601	missense	probably damaging	0.98
Z1177:Rab3c	UTSW	13	110260486	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCAGTACCCACATCTTCAAAAG -3'
(R):5'- ACAAGATGCCAGGTTTGGTC -3'

Sequencing Primer
(F):5'- TCTGAAACACAATGTTCTCCAGC -3'
(R):5'- CCAGGTTTGGTCAGAAAGACTCTTC -3'

Posted On

2014-09-17