Mutagenetix > Incidental Mutation

Incidental Mutation 'R2060:Ryr3'

228543

Institutional Source

Beutler Lab

Gene Symbol

Ryr3

Ensembl Gene

ENSMUSG00000057378

Gene Name

ryanodine receptor 3

Synonyms

calcium release channel isoform 3

MMRRC Submission

040065-MU

Accession Numbers

Genbank: NM_177652.2

Essential gene?

Possibly non essential (E-score: 0.470) question?

Stock #

R2060 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112631355-113217096 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112954364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 224 (V224A)

Ref Sequence

ENSEMBL: ENSMUSP00000147250 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080673
AA Change: V224A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: V224A

Domain	Start	End	E-Value	Type
low complexity region	90	99	N/A	INTRINSIC
MIR	100	155	3.27e-4	SMART
MIR	162	207	7.52e-4	SMART
MIR	215	269	8.06e-4	SMART
MIR	275	368	8.4e-25	SMART
Pfam:RYDR_ITPR	438	642	1.1e-71	PFAM
SPRY	657	795	1.16e-24	SMART
Pfam:RyR	848	942	1.5e-34	PFAM
Pfam:RyR	962	1056	1.2e-32	PFAM
SPRY	1084	1207	7.99e-37	SMART
SPRY	1325	1465	6.25e-30	SMART
low complexity region	1757	1772	N/A	INTRINSIC
low complexity region	1773	1788	N/A	INTRINSIC
low complexity region	1932	1957	N/A	INTRINSIC
Pfam:RYDR_ITPR	2018	2228	1.8e-59	PFAM
Pfam:RyR	2595	2689	1.2e-36	PFAM
Pfam:RyR	2713	2801	2.1e-31	PFAM
low complexity region	2877	2887	N/A	INTRINSIC
low complexity region	3169	3184	N/A	INTRINSIC
low complexity region	3327	3338	N/A	INTRINSIC
PDB:2BCX\|B	3462	3491	9e-12	PDB
low complexity region	3532	3540	N/A	INTRINSIC
coiled coil region	3585	3614	N/A	INTRINSIC
Pfam:RIH_assoc	3715	3848	4.9e-40	PFAM
low complexity region	3855	3875	N/A	INTRINSIC
SCOP:d1sra__	3893	3989	1e-10	SMART
low complexity region	4096	4134	N/A	INTRINSIC
transmembrane domain	4178	4200	N/A	INTRINSIC
Pfam:RR_TM4-6	4227	4497	4.7e-96	PFAM
Pfam:Ion_trans	4599	4762	2e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091818
AA Change: V244A

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: V244A

Domain	Start	End	E-Value	Type
low complexity region	110	119	N/A	INTRINSIC
MIR	120	175	3.27e-4	SMART
MIR	182	227	7.52e-4	SMART
MIR	235	289	8.06e-4	SMART
MIR	295	388	8.4e-25	SMART
Pfam:RYDR_ITPR	460	655	1.2e-64	PFAM
SPRY	677	815	1.16e-24	SMART
Pfam:RyR	869	959	3.3e-38	PFAM
Pfam:RyR	983	1073	2.5e-32	PFAM
SPRY	1104	1227	7.99e-37	SMART
SPRY	1345	1485	6.25e-30	SMART
low complexity region	1777	1792	N/A	INTRINSIC
low complexity region	1793	1808	N/A	INTRINSIC
low complexity region	1952	1977	N/A	INTRINSIC
Pfam:RYDR_ITPR	2040	2248	5.8e-67	PFAM
Pfam:RyR	2616	2706	6.3e-33	PFAM
Pfam:RyR	2734	2818	6.6e-26	PFAM
low complexity region	2897	2907	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
PDB:2BCX\|B	3487	3516	1e-11	PDB
low complexity region	3557	3565	N/A	INTRINSIC
coiled coil region	3610	3639	N/A	INTRINSIC
Pfam:RIH_assoc	3744	3862	3.5e-34	PFAM
low complexity region	3880	3900	N/A	INTRINSIC
SCOP:d1sra__	3918	4014	1e-10	SMART
low complexity region	4121	4159	N/A	INTRINSIC
transmembrane domain	4203	4225	N/A	INTRINSIC
Pfam:RR_TM4-6	4252	4522	1.1e-98	PFAM
Pfam:Ion_trans	4625	4799	6.2e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000134358
AA Change: V224A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208151
AA Change: V224A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208290
AA Change: V224A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 129 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abca14	G	A	7: 120,227,518	W462*	probably null	Het
Aftph	A	T	11: 20,692,571	Y821N	probably damaging	Het
Ahnak	A	T	19: 9,008,041	M2230L	probably benign	Het
Arfgap1	T	C	2: 180,972,782	F144L	probably benign	Het
Arid4b	C	T	13: 14,195,452	R1178C	probably damaging	Het
Asb8	A	T	15: 98,141,373	C49S	possibly damaging	Het
Baz1b	A	G	5: 135,205,114	N165S	probably damaging	Het
BC017158	A	G	7: 128,288,331	L176P	probably damaging	Het
Bod1l	A	T	5: 41,808,742	I2660N	possibly damaging	Het
C2cd3	T	C	7: 100,454,948	I825T	probably damaging	Het
C4b	A	G	17: 34,736,101	W804R	probably damaging	Het
Cadm3	A	T	1: 173,344,402	D201E	probably damaging	Het
Cdh17	T	C	4: 11,803,982	F552L	probably benign	Het
Cdh7	G	C	1: 110,048,877	A91P	probably damaging	Het
Cela1	A	G	15: 100,675,322		probably null	Het
Clk3	T	C	9: 57,751,117	Y582C	probably damaging	Het
Cma1	C	T	14: 55,943,698		probably null	Het
Ctcfl	A	G	2: 173,118,506	S95P	probably benign	Het
Cylc1	C	A	X: 111,123,123	T391K	unknown	Het
Cyp3a11	T	A	5: 145,855,081	I501L	probably benign	Het
Cyp3a59	T	A	5: 146,104,714	L356Q	probably damaging	Het
Dcdc2a	A	C	13: 25,107,710	D226A	possibly damaging	Het
Dlec1	A	C	9: 119,112,086	T235P	probably damaging	Het
Dnaaf1	G	A	8: 119,590,602	R290Q	probably benign	Het
Dnaaf5	C	T	5: 139,178,003	R377W	probably damaging	Het
Dpep1	T	A	8: 123,200,391	V293E	probably damaging	Het
Drosha	T	A	15: 12,924,159	V1209E	possibly damaging	Het
Dync2h1	T	G	9: 7,162,802	I596L	possibly damaging	Het
Edem1	T	A	6: 108,854,287	Y570N	probably damaging	Het
Edrf1	G	T	7: 133,657,129	E9*	probably null	Het
Enpep	T	A	3: 129,280,523	N792Y	probably benign	Het
Enpp2	A	T	15: 54,875,714	M391K	probably damaging	Het
Fanca	A	C	8: 123,274,481	V1105G	probably damaging	Het
Fbxo22	T	A	9: 55,218,383	L74I	probably damaging	Het
Fchsd2	T	A	7: 101,277,417	F571L	probably benign	Het
Fhad1	T	C	4: 141,899,249	D1345G	probably benign	Het
G2e3	T	C	12: 51,372,606	F702L	probably damaging	Het
Glce	A	T	9: 62,060,946	S308T	possibly damaging	Het
Glt1d1	A	G	5: 127,657,119	D119G	probably benign	Het
Gpr137c	T	C	14: 45,244,159	I144T	probably damaging	Het
Gprin3	A	G	6: 59,354,519	C268R	possibly damaging	Het
Hadha	G	A	5: 30,128,836	T395M	probably benign	Het
Hdhd2	T	G	18: 76,965,042		probably null	Het
Homer2	C	T	7: 81,618,703	E70K	probably benign	Het
Hp1bp3	T	A	4: 138,240,672	D397E	probably damaging	Het
Hrh3	T	C	2: 180,101,250	N195S	possibly damaging	Het
Hyou1	T	C	9: 44,381,552	V153A	probably benign	Het
Igf2r	A	T	17: 12,701,319	S1378T	possibly damaging	Het
Ints4	G	A	7: 97,501,763	R279H	possibly damaging	Het
Itga10	A	T	3: 96,654,998	R699*	probably null	Het
Itpkb	A	G	1: 180,421,858	T933A	probably benign	Het
Itsn2	T	G	12: 4,627,879	F79V	probably damaging	Het
Jak3	C	A	8: 71,680,714	C350*	probably null	Het
Jak3	A	T	8: 71,683,415	K620*	probably null	Het
Kcnq5	T	C	1: 21,461,597	S421G	probably benign	Het
Kdm2b	A	T	5: 122,883,365	M50K	probably damaging	Het
Klk1b1	A	G	7: 43,970,623	D170G	possibly damaging	Het
Lama3	A	T	18: 12,528,726	T2160S	probably benign	Het
Lman1	A	T	18: 65,998,352		probably benign	Het
Lmtk3	G	A	7: 45,800,911		probably null	Het
Ltb	A	G	17: 35,195,763	R180G	probably damaging	Het
Ltbp4	C	T	7: 27,308,953	R1310Q	probably damaging	Het
Macf1	T	A	4: 123,499,919		probably null	Het
Mast4	G	T	13: 102,738,846	P1146Q	probably damaging	Het
Micall2	C	T	5: 139,711,562	S678N	probably damaging	Het
Mon2	A	T	10: 122,995,776	I1675N	probably damaging	Het
Mug2	A	G	6: 122,079,612	N1172S	probably benign	Het
Naa30	C	G	14: 49,173,099	S161R	possibly damaging	Het
Ncaph	T	C	2: 127,124,875	N220D	probably damaging	Het
Nell1	T	C	7: 50,560,830	V497A	possibly damaging	Het
Ngly1	A	G	14: 16,277,877	N142S	possibly damaging	Het
Nin	T	A	12: 70,042,418	T1408S	possibly damaging	Het
Nlrp4g	T	A	9: 124,349,693		noncoding transcript	Het
Nrg1	T	G	8: 31,918,015	E63D	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1167	T	C	2: 88,149,143	Y292C	probably damaging	Het
Olfr128	A	G	17: 37,923,880	T105A	probably benign	Het
Olfr473	C	T	7: 107,933,661	T47M	probably benign	Het
Olfr522	T	A	7: 140,162,824	E42V	probably damaging	Het
Olfr845	A	G	9: 19,339,056	I199V	probably benign	Het
Olfr851	T	A	9: 19,497,237	V163E	possibly damaging	Het
Olfr867	A	T	9: 20,054,596	I289N	probably damaging	Het
Olfr998	G	A	2: 85,591,283	V248I	possibly damaging	Het
Orc5	C	T	5: 22,516,703		probably null	Het
Pard3	G	A	8: 127,398,604	R691Q	probably benign	Het
Pofut1	T	A	2: 153,243,660	D54E	probably benign	Het
Prl2c5	T	A	13: 13,190,653	V128E	probably damaging	Het
Ptk7	T	C	17: 46,566,238	M965V	possibly damaging	Het
Pum2	C	T	12: 8,728,726	R459*	probably null	Het
Pzp	A	T	6: 128,483,710	N1494K	probably benign	Het
Rad21l	A	G	2: 151,645,429	V545A	probably benign	Het
Rps6kc1	A	T	1: 190,810,108	M352K	possibly damaging	Het
Rpusd2	G	A	2: 119,037,215		probably null	Het
Rsph14	A	T	10: 75,029,771	D78E	probably damaging	Het
Rtl9	A	T	X: 143,102,030	M813L	possibly damaging	Het
Rtp4	A	T	16: 23,612,940	H74L	probably damaging	Het
Rusc1	G	A	3: 89,087,848	T725I	possibly damaging	Het
Ryr2	C	T	13: 11,595,736	C4068Y	probably damaging	Het
Shprh	A	T	10: 11,152,120	N157I	probably benign	Het
Siglece	A	G	7: 43,657,786	I67T	probably benign	Het
Slc9b2	A	T	3: 135,326,266	T296S	probably damaging	Het
Sorbs2	A	G	8: 45,775,629	K276E	probably damaging	Het
Synj2	A	G	17: 6,037,480	T1269A	probably benign	Het
Taar7b	T	C	10: 24,000,675	I246T	possibly damaging	Het
Taldo1	A	G	7: 141,396,154	Y113C	probably damaging	Het
Tarbp1	A	T	8: 126,447,594		probably null	Het
Tars	C	T	15: 11,394,373	M59I	probably benign	Het
Tas2r130	G	A	6: 131,630,817	T5I	probably benign	Het
Tex48	T	C	4: 63,607,415	E77G	probably damaging	Het
Tmco5	A	G	2: 116,892,255	R286G	probably damaging	Het
Trdmt1	A	T	2: 13,519,914	H243Q	probably benign	Het
Ttn	T	A	2: 76,734,294	R26754*	probably null	Het
Ttn	G	A	2: 76,897,580		probably benign	Het
Ubqln3	A	C	7: 104,142,151	L244R	probably damaging	Het
Ubxn1	C	T	19: 8,873,566	R115*	probably null	Het
Umod	T	G	7: 119,476,715	N276T	probably damaging	Het
Unc13c	A	T	9: 73,665,656	L1528Q	probably damaging	Het
Unc80	T	A	1: 66,640,595	H2108Q	possibly damaging	Het
Utp20	A	C	10: 88,774,795	D1442E	probably damaging	Het
Utp4	A	G	8: 106,898,521	Q144R	probably benign	Het
Vmn2r17	T	A	5: 109,427,209	N127K	probably benign	Het
Vmn2r75	T	A	7: 86,165,164	T374S	probably benign	Het
Washc5	A	G	15: 59,350,408	F523L	probably damaging	Het
Wdr3	A	T	3: 100,159,897		probably null	Het
Wdr89	T	C	12: 75,632,988	Y164C	probably damaging	Het
Xpo5	T	C	17: 46,225,091	S550P	probably damaging	Het
Zfp69	T	C	4: 120,930,832	T429A	probably damaging	Het
Zfpm1	G	T	8: 122,336,592	G797C	probably benign	Het

Other mutations in Ryr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Ryr3	APN	2	112660149	missense	probably damaging	0.98
IGL00531:Ryr3	APN	2	112663012	splice site	probably benign
IGL00785:Ryr3	APN	2	112836103	missense	possibly damaging	0.95
IGL00901:Ryr3	APN	2	112886589	missense	probably damaging	1.00
IGL00910:Ryr3	APN	2	112728934	splice site	probably benign
IGL00970:Ryr3	APN	2	112764676	missense	probably damaging	1.00
IGL01083:Ryr3	APN	2	112751846	splice site	probably benign
IGL01105:Ryr3	APN	2	112751805	missense	probably damaging	1.00
IGL01287:Ryr3	APN	2	112709073	missense	probably damaging	1.00
IGL01343:Ryr3	APN	2	112660054	missense	probably damaging	1.00
IGL01472:Ryr3	APN	2	112672248	missense	probably benign	0.20
IGL01552:Ryr3	APN	2	112825883	missense	possibly damaging	0.53
IGL01594:Ryr3	APN	2	112772728	missense	probably damaging	1.00
IGL01723:Ryr3	APN	2	112650111	critical splice donor site	probably null
IGL01837:Ryr3	APN	2	112801320	missense	probably damaging	1.00
IGL01868:Ryr3	APN	2	112803158	splice site	probably benign
IGL01907:Ryr3	APN	2	112869001	splice site	probably benign
IGL02005:Ryr3	APN	2	112663263	splice site	probably benign
IGL02014:Ryr3	APN	2	112946915	missense	possibly damaging	0.86
IGL02109:Ryr3	APN	2	112949157	missense	probably benign
IGL02178:Ryr3	APN	2	112825799	missense	probably benign	0.17
IGL02185:Ryr3	APN	2	112967203	missense	probably damaging	0.99
IGL02189:Ryr3	APN	2	112754838	splice site	probably benign
IGL02200:Ryr3	APN	2	112849510	missense	probably damaging	0.98
IGL02302:Ryr3	APN	2	112964356	missense	probably damaging	1.00
IGL02305:Ryr3	APN	2	112645277	missense	probably damaging	0.96
IGL02306:Ryr3	APN	2	112834114	missense	probably damaging	0.98
IGL02306:Ryr3	APN	2	112847399	critical splice donor site	probably null
IGL02340:Ryr3	APN	2	112947004	splice site	probably benign
IGL02398:Ryr3	APN	2	112847422	missense	probably benign	0.05
IGL02407:Ryr3	APN	2	112754958	missense	probably damaging	1.00
IGL02426:Ryr3	APN	2	112900905	missense	possibly damaging	0.59
IGL02452:Ryr3	APN	2	112833990	missense	probably damaging	1.00
IGL02453:Ryr3	APN	2	112681728	splice site	probably benign
IGL02585:Ryr3	APN	2	112712303	missense	probably damaging	1.00
IGL02724:Ryr3	APN	2	112902576	critical splice donor site	probably null
IGL02817:Ryr3	APN	2	112844623	critical splice donor site	probably null
IGL02861:Ryr3	APN	2	112652841	missense	possibly damaging	0.89
IGL03038:Ryr3	APN	2	112668120	missense	possibly damaging	0.83
IGL03059:Ryr3	APN	2	112800047	missense	probably damaging	1.00
IGL03136:Ryr3	APN	2	112675974	splice site	probably benign
IGL03137:Ryr3	APN	2	112910397	missense	probably benign
IGL03166:Ryr3	APN	2	112641112	nonsense	probably null
IGL03177:Ryr3	APN	2	113028671	missense	probably benign	0.39
IGL03205:Ryr3	APN	2	112632142	missense	probably damaging	1.00
IGL03224:Ryr3	APN	2	112954336	nonsense	probably null
IGL03249:Ryr3	APN	2	112640656	missense	probably benign	0.32
IGL03370:Ryr3	APN	2	112756599	missense	possibly damaging	0.69
intruder	UTSW	2	112672246	nonsense	probably null
usurper	UTSW	2	112800022	missense	probably damaging	1.00
ANU74:Ryr3	UTSW	2	112831230	critical splice acceptor site	probably null
BB006:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
BB016:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
F5426:Ryr3	UTSW	2	112766338	splice site	probably benign
PIT4494001:Ryr3	UTSW	2	112841876	missense	probably damaging	0.99
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0085:Ryr3	UTSW	2	112859763	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0116:Ryr3	UTSW	2	112803165	missense	probably damaging	0.99
R0281:Ryr3	UTSW	2	112686810	missense	probably damaging	1.00
R0302:Ryr3	UTSW	2	112647123	splice site	probably benign
R0306:Ryr3	UTSW	2	112775655	critical splice donor site	probably null
R0445:Ryr3	UTSW	2	112866054	missense	probably benign	0.16
R0463:Ryr3	UTSW	2	112661701	missense	probably damaging	1.00
R0592:Ryr3	UTSW	2	112678481	missense	probably damaging	1.00
R0622:Ryr3	UTSW	2	112662555	missense	probably damaging	1.00
R0656:Ryr3	UTSW	2	112648306	splice site	probably benign
R0735:Ryr3	UTSW	2	112732982	missense	probably benign	0.11
R0783:Ryr3	UTSW	2	112756327	splice site	probably benign
R0789:Ryr3	UTSW	2	112780973	splice site	probably null
R0835:Ryr3	UTSW	2	112650138	missense	probably benign	0.16
R0879:Ryr3	UTSW	2	113030243	missense	probably benign	0.02
R0924:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0930:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0931:Ryr3	UTSW	2	112653702	missense	probably damaging	1.00
R1037:Ryr3	UTSW	2	112869108	missense	probably benign	0.42
R1169:Ryr3	UTSW	2	112733014	missense	probably benign	0.01
R1170:Ryr3	UTSW	2	112946987	missense	probably damaging	1.00
R1178:Ryr3	UTSW	2	112964380	missense	probably benign	0.00
R1187:Ryr3	UTSW	2	112958176	missense	probably damaging	1.00
R1289:Ryr3	UTSW	2	112645285	missense	probably damaging	1.00
R1337:Ryr3	UTSW	2	112779963	missense	possibly damaging	0.46
R1342:Ryr3	UTSW	2	112750803	missense	probably damaging	1.00
R1349:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1372:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1434:Ryr3	UTSW	2	112645259	missense	probably damaging	1.00
R1438:Ryr3	UTSW	2	112757701	missense	probably benign	0.18
R1467:Ryr3	UTSW	2	112753002	splice site	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1474:Ryr3	UTSW	2	112909962	missense	probably damaging	1.00
R1481:Ryr3	UTSW	2	112636522	splice site	probably benign
R1513:Ryr3	UTSW	2	112709197	nonsense	probably null
R1524:Ryr3	UTSW	2	112869082	missense	probably damaging	0.98
R1525:Ryr3	UTSW	2	112678090	missense	probably damaging	1.00
R1526:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R1611:Ryr3	UTSW	2	112653505	missense	possibly damaging	0.72
R1640:Ryr3	UTSW	2	112900833	missense	probably damaging	1.00
R1662:Ryr3	UTSW	2	112709273	missense	probably damaging	0.99
R1764:Ryr3	UTSW	2	112860460	missense	probably damaging	1.00
R1769:Ryr3	UTSW	2	112751768	critical splice donor site	probably null
R1776:Ryr3	UTSW	2	112957253	missense	probably damaging	0.99
R1780:Ryr3	UTSW	2	112867292	missense	probably damaging	0.98
R1840:Ryr3	UTSW	2	112750820	missense	probably damaging	1.00
R1864:Ryr3	UTSW	2	112730328	missense	possibly damaging	0.65
R1872:Ryr3	UTSW	2	112709137	missense	possibly damaging	0.94
R1960:Ryr3	UTSW	2	112794467	missense	probably damaging	1.00
R1994:Ryr3	UTSW	2	112654492	missense	probably null	0.93
R2018:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2019:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2029:Ryr3	UTSW	2	112647016	missense	possibly damaging	0.82
R2051:Ryr3	UTSW	2	112756641	missense	probably damaging	1.00
R2061:Ryr3	UTSW	2	112663004	missense	possibly damaging	0.83
R2067:Ryr3	UTSW	2	112946957	missense	probably damaging	1.00
R2106:Ryr3	UTSW	2	112638129	missense	probably damaging	1.00
R2129:Ryr3	UTSW	2	112678370	splice site	probably benign
R2140:Ryr3	UTSW	2	112875148	missense	probably benign	0.01
R2176:Ryr3	UTSW	2	112666335	missense	possibly damaging	0.48
R2241:Ryr3	UTSW	2	112801392	missense	probably damaging	1.00
R2261:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2262:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2276:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2279:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2403:Ryr3	UTSW	2	112686628	missense	probably damaging	1.00
R2510:Ryr3	UTSW	2	112675904	missense	probably benign	0.18
R2568:Ryr3	UTSW	2	112675874	missense	probably damaging	1.00
R3013:Ryr3	UTSW	2	112640281	missense	probably damaging	1.00
R3431:Ryr3	UTSW	2	112656531	missense	probably damaging	1.00
R3552:Ryr3	UTSW	2	112751787	missense	probably damaging	1.00
R3761:Ryr3	UTSW	2	112754913	missense	probably benign
R3909:Ryr3	UTSW	2	112636608	missense	probably damaging	1.00
R3923:Ryr3	UTSW	2	112841873	missense	possibly damaging	0.92
R3924:Ryr3	UTSW	2	113028703	splice site	probably benign
R3927:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3947:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3949:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3976:Ryr3	UTSW	2	112675837	missense	possibly damaging	0.49
R4004:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4022:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4084:Ryr3	UTSW	2	112900908	missense	probably damaging	0.99
R4106:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4108:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4109:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4131:Ryr3	UTSW	2	112926983	splice site	probably null
R4156:Ryr3	UTSW	2	112653675	missense	probably damaging	1.00
R4172:Ryr3	UTSW	2	112794470	missense	probably damaging	1.00
R4234:Ryr3	UTSW	2	112910407	missense	probably damaging	1.00
R4399:Ryr3	UTSW	2	112946844	missense	probably benign	0.01
R4409:Ryr3	UTSW	2	112730308	missense	probably damaging	1.00
R4418:Ryr3	UTSW	2	112831224	missense	probably damaging	1.00
R4466:Ryr3	UTSW	2	112653102	missense	possibly damaging	0.92
R4525:Ryr3	UTSW	2	112653621	missense	probably damaging	0.98
R4573:Ryr3	UTSW	2	112755174	splice site	probably null
R4589:Ryr3	UTSW	2	112875133	missense	probably damaging	1.00
R4653:Ryr3	UTSW	2	112652763	missense	probably damaging	1.00
R4664:Ryr3	UTSW	2	112996555	intron	probably benign
R4710:Ryr3	UTSW	2	112766301	missense	probably damaging	1.00
R4734:Ryr3	UTSW	2	112910502	missense	probably damaging	0.99
R4741:Ryr3	UTSW	2	112803268	missense	probably damaging	0.99
R4748:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4749:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4754:Ryr3	UTSW	2	112757639	missense	possibly damaging	0.94
R4764:Ryr3	UTSW	2	112733031	critical splice acceptor site	probably null
R4812:Ryr3	UTSW	2	112912236	missense	probably damaging	1.00
R4822:Ryr3	UTSW	2	112652745	missense	probably damaging	1.00
R4841:Ryr3	UTSW	2	112648373	missense	probably damaging	1.00
R4849:Ryr3	UTSW	2	112908462	missense	probably damaging	1.00
R4917:Ryr3	UTSW	2	112831185	missense	probably damaging	1.00
R4942:Ryr3	UTSW	2	112836257	missense	probably damaging	0.99
R4990:Ryr3	UTSW	2	112635777	missense	probably damaging	1.00
R4990:Ryr3	UTSW	2	112909973	missense	probably damaging	1.00
R5049:Ryr3	UTSW	2	112640171	missense	probably damaging	1.00
R5055:Ryr3	UTSW	2	112831159	missense	probably benign	0.00
R5112:Ryr3	UTSW	2	112902665	missense	probably damaging	1.00
R5160:Ryr3	UTSW	2	112646927	missense	probably damaging	1.00
R5169:Ryr3	UTSW	2	112670660	missense	possibly damaging	0.63
R5176:Ryr3	UTSW	2	112757667	missense	possibly damaging	0.95
R5182:Ryr3	UTSW	2	112755150	missense	probably damaging	1.00
R5206:Ryr3	UTSW	2	112844711	missense	probably damaging	1.00
R5263:Ryr3	UTSW	2	112718002	missense	possibly damaging	0.65
R5272:Ryr3	UTSW	2	112653213	missense	probably damaging	1.00
R5332:Ryr3	UTSW	2	112902693	missense	probably damaging	1.00
R5340:Ryr3	UTSW	2	112834125	missense	probably damaging	0.99
R5359:Ryr3	UTSW	2	112775841	splice site	probably null
R5434:Ryr3	UTSW	2	112794469	missense	probably damaging	1.00
R5454:Ryr3	UTSW	2	112730302	splice site	probably null
R5501:Ryr3	UTSW	2	112662504	missense	possibly damaging	0.80
R5560:Ryr3	UTSW	2	112754877	missense	probably damaging	1.00
R5580:Ryr3	UTSW	2	112841948	missense	probably damaging	1.00
R5621:Ryr3	UTSW	2	112900984	nonsense	probably null
R5731:Ryr3	UTSW	2	112641572	missense	probably damaging	1.00
R5757:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5758:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5768:Ryr3	UTSW	2	112753097	missense	probably benign	0.05
R5783:Ryr3	UTSW	2	112652998	missense	probably benign	0.06
R5799:Ryr3	UTSW	2	112686580	missense	probably damaging	1.00
R5829:Ryr3	UTSW	2	112859731	missense	probably damaging	1.00
R5883:Ryr3	UTSW	2	113030292	intron	probably benign
R5911:Ryr3	UTSW	2	112908487	missense	probably damaging	1.00
R5968:Ryr3	UTSW	2	112647049	missense	probably benign	0.22
R5972:Ryr3	UTSW	2	112834064	missense	probably damaging	0.99
R5978:Ryr3	UTSW	2	112672269	missense	probably benign	0.00
R6084:Ryr3	UTSW	2	112908493	missense	probably damaging	1.00
R6117:Ryr3	UTSW	2	112635396	missense	probably damaging	1.00
R6126:Ryr3	UTSW	2	112757670	missense	probably damaging	1.00
R6128:Ryr3	UTSW	2	112954294	critical splice donor site	probably null
R6157:Ryr3	UTSW	2	112841899	missense	probably damaging	0.98
R6258:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6260:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6373:Ryr3	UTSW	2	112656544	missense	probably damaging	1.00
R6377:Ryr3	UTSW	2	112632185	missense	probably damaging	1.00
R6443:Ryr3	UTSW	2	112675933	missense	possibly damaging	0.88
R6478:Ryr3	UTSW	2	112660068	missense	probably damaging	1.00
R6512:Ryr3	UTSW	2	112867378	missense	possibly damaging	0.83
R6684:Ryr3	UTSW	2	112753088	missense	probably damaging	1.00
R6753:Ryr3	UTSW	2	112652610	missense	probably damaging	0.99
R6812:Ryr3	UTSW	2	112946906	missense	probably damaging	1.00
R6910:Ryr3	UTSW	2	112958175	missense	probably damaging	1.00
R6930:Ryr3	UTSW	2	112860354	missense	probably damaging	1.00
R6946:Ryr3	UTSW	2	112831200	missense	probably damaging	1.00
R6950:Ryr3	UTSW	2	112686825	missense	possibly damaging	0.78
R6973:Ryr3	UTSW	2	112766311	missense	probably damaging	0.99
R6984:Ryr3	UTSW	2	112875091	missense	probably damaging	1.00
R7020:Ryr3	UTSW	2	112753078	missense	probably benign	0.00
R7037:Ryr3	UTSW	2	112949130	nonsense	probably null
R7166:Ryr3	UTSW	2	112875028	missense	probably damaging	1.00
R7172:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R7177:Ryr3	UTSW	2	112900843	missense	probably damaging	1.00
R7188:Ryr3	UTSW	2	113028644	missense	probably damaging	1.00
R7202:Ryr3	UTSW	2	112766319	missense	probably damaging	1.00
R7228:Ryr3	UTSW	2	112861852	missense	probably damaging	1.00
R7256:Ryr3	UTSW	2	112672246	nonsense	probably null
R7293:Ryr3	UTSW	2	112902603	missense	probably benign	0.13
R7331:Ryr3	UTSW	2	112763665	missense	possibly damaging	0.80
R7380:Ryr3	UTSW	2	112640157	missense	probably damaging	1.00
R7391:Ryr3	UTSW	2	112780977	critical splice donor site	probably null
R7455:Ryr3	UTSW	2	112728866	missense	probably damaging	0.99
R7466:Ryr3	UTSW	2	112926957	missense	probably benign	0.40
R7481:Ryr3	UTSW	2	112678093	missense	probably benign	0.16
R7481:Ryr3	UTSW	2	112678094	missense	possibly damaging	0.95
R7497:Ryr3	UTSW	2	112730473	missense	probably benign	0.06
R7502:Ryr3	UTSW	2	112712361	missense	probably benign	0.00
R7505:Ryr3	UTSW	2	112712429	missense	probably damaging	0.99
R7581:Ryr3	UTSW	2	112753027	missense	probably damaging	0.99
R7606:Ryr3	UTSW	2	112645245	nonsense	probably null
R7677:Ryr3	UTSW	2	112833900	missense	probably benign
R7703:Ryr3	UTSW	2	112859765	missense	probably damaging	1.00
R7713:Ryr3	UTSW	2	112635346	missense	probably benign	0.12
R7784:Ryr3	UTSW	2	112775695	missense	probably damaging	1.00
R7831:Ryr3	UTSW	2	112926838	missense	possibly damaging	0.92
R7851:Ryr3	UTSW	2	112678517	missense	probably benign	0.05
R7873:Ryr3	UTSW	2	112730428	missense	probably benign	0.28
R7890:Ryr3	UTSW	2	112926912	missense	probably damaging	1.00
R7899:Ryr3	UTSW	2	112646950	missense	possibly damaging	0.86
R7904:Ryr3	UTSW	2	112781024	missense	probably damaging	1.00
R7929:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
R7982:Ryr3	UTSW	2	112669249	small deletion	probably benign
R8018:Ryr3	UTSW	2	112678432	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112775664	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112875077	missense	probably damaging	1.00
R8095:Ryr3	UTSW	2	112668043	critical splice donor site	probably null
R8097:Ryr3	UTSW	2	112670270	splice site	probably null
R8181:Ryr3	UTSW	2	112778243	missense	probably damaging	0.98
R8276:Ryr3	UTSW	2	112640617	missense	probably damaging	1.00
R8329:Ryr3	UTSW	2	112662510	missense	possibly damaging	0.94
R8345:Ryr3	UTSW	2	112652925	missense	probably benign	0.01
R8361:Ryr3	UTSW	2	112653130	missense	probably damaging	0.98
R8421:Ryr3	UTSW	2	112996584	missense	probably benign	0.00
R8424:Ryr3	UTSW	2	112841894	missense	possibly damaging	0.91
R8471:Ryr3	UTSW	2	112653780	missense	probably damaging	1.00
R8505:Ryr3	UTSW	2	112675870	missense	probably damaging	0.98
R8535:Ryr3	UTSW	2	112949088	critical splice donor site	probably null
R8540:Ryr3	UTSW	2	112800022	missense	probably damaging	1.00
R8722:Ryr3	UTSW	2	112772771	missense	probably benign	0.12
R8818:Ryr3	UTSW	2	112831096	missense	probably damaging	1.00
R8819:Ryr3	UTSW	2	112635792	missense	probably damaging	1.00
R8819:Ryr3	UTSW	2	112859724	missense	probably benign	0.01
R8820:Ryr3	UTSW	2	112635792	missense	probably damaging	1.00
R8820:Ryr3	UTSW	2	112859724	missense	probably benign	0.01
R8852:Ryr3	UTSW	2	112794499	missense	probably damaging	1.00
R8859:Ryr3	UTSW	2	112653219	missense	probably damaging	0.98
R8896:Ryr3	UTSW	2	112753050	nonsense	probably null
R8916:Ryr3	UTSW	2	112778290	missense	probably damaging	1.00
R8935:Ryr3	UTSW	2	112678057	missense	probably benign	0.33
R8943:Ryr3	UTSW	2	112635324	missense	probably damaging	1.00
R8963:Ryr3	UTSW	2	112836670	critical splice donor site	probably null
R8974:Ryr3	UTSW	2	112912279	missense	possibly damaging	0.74
R9008:Ryr3	UTSW	2	112635403	missense	probably damaging	0.98
R9040:Ryr3	UTSW	2	112954386	missense	probably damaging	1.00
R9041:Ryr3	UTSW	2	112957201	missense	probably damaging	0.97
R9102:Ryr3	UTSW	2	112678561	splice site	probably benign
R9167:Ryr3	UTSW	2	112834053	missense	probably damaging	1.00
R9180:Ryr3	UTSW	2	112661636	missense	probably damaging	0.99
R9219:Ryr3	UTSW	2	112912239	missense	possibly damaging	0.62
R9258:Ryr3	UTSW	2	112653019	missense	probably damaging	0.99
R9300:Ryr3	UTSW	2	112860350	missense	probably benign
R9320:Ryr3	UTSW	2	112779991	missense	probably damaging	1.00
R9325:Ryr3	UTSW	2	112649295	missense	probably damaging	0.96
R9405:Ryr3	UTSW	2	112834267	missense	probably damaging	1.00
R9414:Ryr3	UTSW	2	112670666	missense	possibly damaging	0.81
R9489:Ryr3	UTSW	2	112661621	missense	probably damaging	1.00
R9522:Ryr3	UTSW	2	112730414	missense	probably benign	0.34
R9526:Ryr3	UTSW	2	112833925	missense	probably benign
R9529:Ryr3	UTSW	2	112635315	missense	possibly damaging	0.70
R9605:Ryr3	UTSW	2	112661621	missense	probably damaging	1.00
R9652:Ryr3	UTSW	2	112804702	missense	possibly damaging	0.66
R9660:Ryr3	UTSW	2	112833729	missense	probably benign
R9670:Ryr3	UTSW	2	112730500	missense	probably benign	0.28
R9673:Ryr3	UTSW	2	112656538	missense	possibly damaging	0.93
R9710:Ryr3	UTSW	2	112803189	missense	probably damaging	0.99
R9741:Ryr3	UTSW	2	112646926	missense	probably benign	0.00
R9772:Ryr3	UTSW	2	112826703	missense	probably damaging	0.96
RF010:Ryr3	UTSW	2	112775670	missense	probably damaging	0.97
RF040:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
RF044:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
X0057:Ryr3	UTSW	2	112640159	missense	probably damaging	1.00
X0064:Ryr3	UTSW	2	112912302	missense	probably benign	0.26
Z1088:Ryr3	UTSW	2	112900916	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112675920	missense	probably benign	0.05
Z1176:Ryr3	UTSW	2	112712374	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112728924	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGAGCAAACTGGAGCTTGTGG -3'
(R):5'- CCACTGAGGCCTTAATTCGG -3'

Sequencing Primer
(F):5'- TGGCTAGATGAAGGTCAGTCC -3'
(R):5'- AGGCCTTAATTCGGGGACTCTATAC -3'

Posted On

2014-09-17