Mutagenetix > Incidental Mutation

Incidental Mutation 'R2060:Ctcfl'

228549

Institutional Source

Beutler Lab

Gene Symbol

Ctcfl

Ensembl Gene

ENSMUSG00000070495

Gene Name

CCCTC-binding factor (zinc finger protein)-like

Synonyms

Boris, OTTMUSG00000016680

MMRRC Submission

040065-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R2060 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

173093609-173119525 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 173118506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 95 (S95P)

Ref Sequence

ENSEMBL: ENSMUSP00000135932 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094287] [ENSMUST00000179693]

AlphaFold

A2APF3

Predicted Effect

probably benign
Transcript: ENSMUST00000094287
AA Change: S95P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000091845
Gene: ENSMUSG00000070495
AA Change: S95P

Domain	Start	End	E-Value	Type
low complexity region	194	202	N/A	INTRINSIC
ZnF_C2H2	257	279	1.79e-2	SMART
ZnF_C2H2	285	307	1.07e0	SMART
ZnF_C2H2	313	336	4.47e-3	SMART
ZnF_C2H2	342	364	1.79e-2	SMART
ZnF_C2H2	370	392	5.81e-2	SMART
ZnF_C2H2	398	421	1.36e-2	SMART
ZnF_C2H2	428	451	6.23e-2	SMART
ZnF_C2H2	458	480	1.89e-1	SMART
ZnF_C2H2	486	508	8.94e-3	SMART
ZnF_C2H2	514	537	2.32e-1	SMART
ZnF_C2H2	546	572	5.2e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144256

Predicted Effect

probably benign
Transcript: ENSMUST00000179693
AA Change: S95P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000135932
Gene: ENSMUSG00000070495
AA Change: S95P

Domain	Start	End	E-Value	Type
low complexity region	194	202	N/A	INTRINSIC
ZnF_C2H2	257	279	1.79e-2	SMART
ZnF_C2H2	285	307	1.07e0	SMART
ZnF_C2H2	313	336	4.47e-3	SMART
ZnF_C2H2	342	364	1.79e-2	SMART
ZnF_C2H2	370	392	5.81e-2	SMART
ZnF_C2H2	398	421	1.36e-2	SMART
ZnF_C2H2	428	451	6.23e-2	SMART
ZnF_C2H2	458	480	1.89e-1	SMART
ZnF_C2H2	486	508	8.94e-3	SMART
ZnF_C2H2	514	537	2.32e-1	SMART
ZnF_C2H2	546	572	5.2e0	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small testes, delayed spermatid development, and increased male germ cell apoptosis without affecting fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 129 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abca14	G	A	7: 120,227,518	W462*	probably null	Het
Aftph	A	T	11: 20,692,571	Y821N	probably damaging	Het
Ahnak	A	T	19: 9,008,041	M2230L	probably benign	Het
Arfgap1	T	C	2: 180,972,782	F144L	probably benign	Het
Arid4b	C	T	13: 14,195,452	R1178C	probably damaging	Het
Asb8	A	T	15: 98,141,373	C49S	possibly damaging	Het
Baz1b	A	G	5: 135,205,114	N165S	probably damaging	Het
BC017158	A	G	7: 128,288,331	L176P	probably damaging	Het
Bod1l	A	T	5: 41,808,742	I2660N	possibly damaging	Het
C2cd3	T	C	7: 100,454,948	I825T	probably damaging	Het
C4b	A	G	17: 34,736,101	W804R	probably damaging	Het
Cadm3	A	T	1: 173,344,402	D201E	probably damaging	Het
Cdh17	T	C	4: 11,803,982	F552L	probably benign	Het
Cdh7	G	C	1: 110,048,877	A91P	probably damaging	Het
Cela1	A	G	15: 100,675,322		probably null	Het
Clk3	T	C	9: 57,751,117	Y582C	probably damaging	Het
Cma1	C	T	14: 55,943,698		probably null	Het
Cylc1	C	A	X: 111,123,123	T391K	unknown	Het
Cyp3a11	T	A	5: 145,855,081	I501L	probably benign	Het
Cyp3a59	T	A	5: 146,104,714	L356Q	probably damaging	Het
Dcdc2a	A	C	13: 25,107,710	D226A	possibly damaging	Het
Dlec1	A	C	9: 119,112,086	T235P	probably damaging	Het
Dnaaf1	G	A	8: 119,590,602	R290Q	probably benign	Het
Dnaaf5	C	T	5: 139,178,003	R377W	probably damaging	Het
Dpep1	T	A	8: 123,200,391	V293E	probably damaging	Het
Drosha	T	A	15: 12,924,159	V1209E	possibly damaging	Het
Dync2h1	T	G	9: 7,162,802	I596L	possibly damaging	Het
Edem1	T	A	6: 108,854,287	Y570N	probably damaging	Het
Edrf1	G	T	7: 133,657,129	E9*	probably null	Het
Enpep	T	A	3: 129,280,523	N792Y	probably benign	Het
Enpp2	A	T	15: 54,875,714	M391K	probably damaging	Het
Fanca	A	C	8: 123,274,481	V1105G	probably damaging	Het
Fbxo22	T	A	9: 55,218,383	L74I	probably damaging	Het
Fchsd2	T	A	7: 101,277,417	F571L	probably benign	Het
Fhad1	T	C	4: 141,899,249	D1345G	probably benign	Het
G2e3	T	C	12: 51,372,606	F702L	probably damaging	Het
Glce	A	T	9: 62,060,946	S308T	possibly damaging	Het
Glt1d1	A	G	5: 127,657,119	D119G	probably benign	Het
Gpr137c	T	C	14: 45,244,159	I144T	probably damaging	Het
Gprin3	A	G	6: 59,354,519	C268R	possibly damaging	Het
Hadha	G	A	5: 30,128,836	T395M	probably benign	Het
Hdhd2	T	G	18: 76,965,042		probably null	Het
Homer2	C	T	7: 81,618,703	E70K	probably benign	Het
Hp1bp3	T	A	4: 138,240,672	D397E	probably damaging	Het
Hrh3	T	C	2: 180,101,250	N195S	possibly damaging	Het
Hyou1	T	C	9: 44,381,552	V153A	probably benign	Het
Igf2r	A	T	17: 12,701,319	S1378T	possibly damaging	Het
Ints4	G	A	7: 97,501,763	R279H	possibly damaging	Het
Itga10	A	T	3: 96,654,998	R699*	probably null	Het
Itpkb	A	G	1: 180,421,858	T933A	probably benign	Het
Itsn2	T	G	12: 4,627,879	F79V	probably damaging	Het
Jak3	C	A	8: 71,680,714	C350*	probably null	Het
Jak3	A	T	8: 71,683,415	K620*	probably null	Het
Kcnq5	T	C	1: 21,461,597	S421G	probably benign	Het
Kdm2b	A	T	5: 122,883,365	M50K	probably damaging	Het
Klk1b1	A	G	7: 43,970,623	D170G	possibly damaging	Het
Lama3	A	T	18: 12,528,726	T2160S	probably benign	Het
Lman1	A	T	18: 65,998,352		probably benign	Het
Lmtk3	G	A	7: 45,800,911		probably null	Het
Ltb	A	G	17: 35,195,763	R180G	probably damaging	Het
Ltbp4	C	T	7: 27,308,953	R1310Q	probably damaging	Het
Macf1	T	A	4: 123,499,919		probably null	Het
Mast4	G	T	13: 102,738,846	P1146Q	probably damaging	Het
Micall2	C	T	5: 139,711,562	S678N	probably damaging	Het
Mon2	A	T	10: 122,995,776	I1675N	probably damaging	Het
Mug2	A	G	6: 122,079,612	N1172S	probably benign	Het
Naa30	C	G	14: 49,173,099	S161R	possibly damaging	Het
Ncaph	T	C	2: 127,124,875	N220D	probably damaging	Het
Nell1	T	C	7: 50,560,830	V497A	possibly damaging	Het
Ngly1	A	G	14: 16,277,877	N142S	possibly damaging	Het
Nin	T	A	12: 70,042,418	T1408S	possibly damaging	Het
Nlrp4g	T	A	9: 124,349,693		noncoding transcript	Het
Nrg1	T	G	8: 31,918,015	E63D	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1167	T	C	2: 88,149,143	Y292C	probably damaging	Het
Olfr128	A	G	17: 37,923,880	T105A	probably benign	Het
Olfr473	C	T	7: 107,933,661	T47M	probably benign	Het
Olfr522	T	A	7: 140,162,824	E42V	probably damaging	Het
Olfr845	A	G	9: 19,339,056	I199V	probably benign	Het
Olfr851	T	A	9: 19,497,237	V163E	possibly damaging	Het
Olfr867	A	T	9: 20,054,596	I289N	probably damaging	Het
Olfr998	G	A	2: 85,591,283	V248I	possibly damaging	Het
Orc5	C	T	5: 22,516,703		probably null	Het
Pard3	G	A	8: 127,398,604	R691Q	probably benign	Het
Pofut1	T	A	2: 153,243,660	D54E	probably benign	Het
Prl2c5	T	A	13: 13,190,653	V128E	probably damaging	Het
Ptk7	T	C	17: 46,566,238	M965V	possibly damaging	Het
Pum2	C	T	12: 8,728,726	R459*	probably null	Het
Pzp	A	T	6: 128,483,710	N1494K	probably benign	Het
Rad21l	A	G	2: 151,645,429	V545A	probably benign	Het
Rps6kc1	A	T	1: 190,810,108	M352K	possibly damaging	Het
Rpusd2	G	A	2: 119,037,215		probably null	Het
Rsph14	A	T	10: 75,029,771	D78E	probably damaging	Het
Rtl9	A	T	X: 143,102,030	M813L	possibly damaging	Het
Rtp4	A	T	16: 23,612,940	H74L	probably damaging	Het
Rusc1	G	A	3: 89,087,848	T725I	possibly damaging	Het
Ryr2	C	T	13: 11,595,736	C4068Y	probably damaging	Het
Ryr3	A	G	2: 112,954,364	V224A	possibly damaging	Het
Shprh	A	T	10: 11,152,120	N157I	probably benign	Het
Siglece	A	G	7: 43,657,786	I67T	probably benign	Het
Slc9b2	A	T	3: 135,326,266	T296S	probably damaging	Het
Sorbs2	A	G	8: 45,775,629	K276E	probably damaging	Het
Synj2	A	G	17: 6,037,480	T1269A	probably benign	Het
Taar7b	T	C	10: 24,000,675	I246T	possibly damaging	Het
Taldo1	A	G	7: 141,396,154	Y113C	probably damaging	Het
Tarbp1	A	T	8: 126,447,594		probably null	Het
Tars	C	T	15: 11,394,373	M59I	probably benign	Het
Tas2r130	G	A	6: 131,630,817	T5I	probably benign	Het
Tex48	T	C	4: 63,607,415	E77G	probably damaging	Het
Tmco5	A	G	2: 116,892,255	R286G	probably damaging	Het
Trdmt1	A	T	2: 13,519,914	H243Q	probably benign	Het
Ttn	T	A	2: 76,734,294	R26754*	probably null	Het
Ttn	G	A	2: 76,897,580		probably benign	Het
Ubqln3	A	C	7: 104,142,151	L244R	probably damaging	Het
Ubxn1	C	T	19: 8,873,566	R115*	probably null	Het
Umod	T	G	7: 119,476,715	N276T	probably damaging	Het
Unc13c	A	T	9: 73,665,656	L1528Q	probably damaging	Het
Unc80	T	A	1: 66,640,595	H2108Q	possibly damaging	Het
Utp20	A	C	10: 88,774,795	D1442E	probably damaging	Het
Utp4	A	G	8: 106,898,521	Q144R	probably benign	Het
Vmn2r17	T	A	5: 109,427,209	N127K	probably benign	Het
Vmn2r75	T	A	7: 86,165,164	T374S	probably benign	Het
Washc5	A	G	15: 59,350,408	F523L	probably damaging	Het
Wdr3	A	T	3: 100,159,897		probably null	Het
Wdr89	T	C	12: 75,632,988	Y164C	probably damaging	Het
Xpo5	T	C	17: 46,225,091	S550P	probably damaging	Het
Zfp69	T	C	4: 120,930,832	T429A	probably damaging	Het
Zfpm1	G	T	8: 122,336,592	G797C	probably benign	Het

Other mutations in Ctcfl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01344:Ctcfl	APN	2	173094734	missense	possibly damaging	0.82
IGL01418:Ctcfl	APN	2	173118331	missense	probably benign	0.03
IGL01524:Ctcfl	APN	2	173117384	missense	probably benign	0.08
IGL02610:Ctcfl	APN	2	173106026	splice site	probably benign
IGL02961:Ctcfl	APN	2	173101919	missense	possibly damaging	0.70
BB001:Ctcfl	UTSW	2	173113656	missense	possibly damaging	0.71
BB011:Ctcfl	UTSW	2	173113656	missense	possibly damaging	0.71
R0147:Ctcfl	UTSW	2	173118547	missense	possibly damaging	0.75
R0148:Ctcfl	UTSW	2	173118547	missense	possibly damaging	0.75
R0362:Ctcfl	UTSW	2	173118443	missense	probably damaging	0.99
R1099:Ctcfl	UTSW	2	173112360	missense	probably damaging	1.00
R1540:Ctcfl	UTSW	2	173112348	missense	probably benign	0.36
R1892:Ctcfl	UTSW	2	173118685	missense	probably benign	0.24
R2036:Ctcfl	UTSW	2	173101985	missense	possibly damaging	0.95
R2925:Ctcfl	UTSW	2	173094696	missense	probably damaging	1.00
R4327:Ctcfl	UTSW	2	173113506	intron	probably benign
R4837:Ctcfl	UTSW	2	173113656	missense	probably benign	0.00
R4894:Ctcfl	UTSW	2	173117403	missense	probably benign	0.19
R4909:Ctcfl	UTSW	2	173095398	missense	probably benign	0.42
R5128:Ctcfl	UTSW	2	173117396	missense	probably benign	0.00
R5247:Ctcfl	UTSW	2	173113609	missense	probably damaging	1.00
R6263:Ctcfl	UTSW	2	173095337	missense	probably benign	0.00
R6768:Ctcfl	UTSW	2	173117291	missense	possibly damaging	0.84
R7045:Ctcfl	UTSW	2	173112374	missense	probably damaging	1.00
R7180:Ctcfl	UTSW	2	173105977	splice site	probably null
R7256:Ctcfl	UTSW	2	173118475	missense	probably benign	0.01
R7268:Ctcfl	UTSW	2	173107795	missense	probably benign	0.26
R7378:Ctcfl	UTSW	2	173112258	missense	probably damaging	1.00
R7560:Ctcfl	UTSW	2	173118406	missense	probably damaging	0.96
R7657:Ctcfl	UTSW	2	173113656	missense	possibly damaging	0.71
R7733:Ctcfl	UTSW	2	173117192	missense	probably benign
R7924:Ctcfl	UTSW	2	173113656	missense	possibly damaging	0.71
R7945:Ctcfl	UTSW	2	173118658	missense	probably benign
R8022:Ctcfl	UTSW	2	173118766	missense	probably benign	0.15
R8038:Ctcfl	UTSW	2	173101905	missense	probably damaging	1.00
R8911:Ctcfl	UTSW	2	173095328	critical splice donor site	probably null
R9031:Ctcfl	UTSW	2	173117251	missense	probably benign	0.07
R9358:Ctcfl	UTSW	2	173118788	start codon destroyed	possibly damaging	0.81
R9401:Ctcfl	UTSW	2	173106088	missense	probably damaging	0.99
R9490:Ctcfl	UTSW	2	173118755	missense	probably benign	0.00
Z1088:Ctcfl	UTSW	2	173118344	missense	probably benign	0.01
Z1177:Ctcfl	UTSW	2	173102036	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTCGGCCATTAGCACATTC -3'
(R):5'- TTGAAGCCTGGAGACCTAGAGG -3'

Sequencing Primer
(F):5'- CTCTCTCAGCAGGTGAAAATGTATCC -3'
(R):5'- GGTACAAAGAGTGGAAGCCC -3'

Posted On

2014-09-17