Mutagenetix > Incidental Mutation

Incidental Mutation 'R2060:Bod1l'

228566

Institutional Source

Beutler Lab

Gene Symbol

Bod1l

Ensembl Gene

ENSMUSG00000061755

Gene Name

biorientation of chromosomes in cell division 1-like

Synonyms

A230054D04Rik

MMRRC Submission

040065-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R2060 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41787538-41844315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41808742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 2660 (I2660N)

Ref Sequence

ENSEMBL: ENSMUSP00000144359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050556
AA Change: I2660N

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: I2660N

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	1.8e-28	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	3.21e-1	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202908
AA Change: I2660N

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: I2660N

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	2.9e-24	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	1.9e-3	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 129 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abca14	G	A	7: 120,227,518	W462*	probably null	Het
Aftph	A	T	11: 20,692,571	Y821N	probably damaging	Het
Ahnak	A	T	19: 9,008,041	M2230L	probably benign	Het
Arfgap1	T	C	2: 180,972,782	F144L	probably benign	Het
Arid4b	C	T	13: 14,195,452	R1178C	probably damaging	Het
Asb8	A	T	15: 98,141,373	C49S	possibly damaging	Het
Baz1b	A	G	5: 135,205,114	N165S	probably damaging	Het
BC017158	A	G	7: 128,288,331	L176P	probably damaging	Het
C2cd3	T	C	7: 100,454,948	I825T	probably damaging	Het
C4b	A	G	17: 34,736,101	W804R	probably damaging	Het
Cadm3	A	T	1: 173,344,402	D201E	probably damaging	Het
Cdh17	T	C	4: 11,803,982	F552L	probably benign	Het
Cdh7	G	C	1: 110,048,877	A91P	probably damaging	Het
Cela1	A	G	15: 100,675,322		probably null	Het
Clk3	T	C	9: 57,751,117	Y582C	probably damaging	Het
Cma1	C	T	14: 55,943,698		probably null	Het
Ctcfl	A	G	2: 173,118,506	S95P	probably benign	Het
Cylc1	C	A	X: 111,123,123	T391K	unknown	Het
Cyp3a11	T	A	5: 145,855,081	I501L	probably benign	Het
Cyp3a59	T	A	5: 146,104,714	L356Q	probably damaging	Het
Dcdc2a	A	C	13: 25,107,710	D226A	possibly damaging	Het
Dlec1	A	C	9: 119,112,086	T235P	probably damaging	Het
Dnaaf1	G	A	8: 119,590,602	R290Q	probably benign	Het
Dnaaf5	C	T	5: 139,178,003	R377W	probably damaging	Het
Dpep1	T	A	8: 123,200,391	V293E	probably damaging	Het
Drosha	T	A	15: 12,924,159	V1209E	possibly damaging	Het
Dync2h1	T	G	9: 7,162,802	I596L	possibly damaging	Het
Edem1	T	A	6: 108,854,287	Y570N	probably damaging	Het
Edrf1	G	T	7: 133,657,129	E9*	probably null	Het
Enpep	T	A	3: 129,280,523	N792Y	probably benign	Het
Enpp2	A	T	15: 54,875,714	M391K	probably damaging	Het
Fanca	A	C	8: 123,274,481	V1105G	probably damaging	Het
Fbxo22	T	A	9: 55,218,383	L74I	probably damaging	Het
Fchsd2	T	A	7: 101,277,417	F571L	probably benign	Het
Fhad1	T	C	4: 141,899,249	D1345G	probably benign	Het
G2e3	T	C	12: 51,372,606	F702L	probably damaging	Het
Glce	A	T	9: 62,060,946	S308T	possibly damaging	Het
Glt1d1	A	G	5: 127,657,119	D119G	probably benign	Het
Gpr137c	T	C	14: 45,244,159	I144T	probably damaging	Het
Gprin3	A	G	6: 59,354,519	C268R	possibly damaging	Het
Hadha	G	A	5: 30,128,836	T395M	probably benign	Het
Hdhd2	T	G	18: 76,965,042		probably null	Het
Homer2	C	T	7: 81,618,703	E70K	probably benign	Het
Hp1bp3	T	A	4: 138,240,672	D397E	probably damaging	Het
Hrh3	T	C	2: 180,101,250	N195S	possibly damaging	Het
Hyou1	T	C	9: 44,381,552	V153A	probably benign	Het
Igf2r	A	T	17: 12,701,319	S1378T	possibly damaging	Het
Ints4	G	A	7: 97,501,763	R279H	possibly damaging	Het
Itga10	A	T	3: 96,654,998	R699*	probably null	Het
Itpkb	A	G	1: 180,421,858	T933A	probably benign	Het
Itsn2	T	G	12: 4,627,879	F79V	probably damaging	Het
Jak3	C	A	8: 71,680,714	C350*	probably null	Het
Jak3	A	T	8: 71,683,415	K620*	probably null	Het
Kcnq5	T	C	1: 21,461,597	S421G	probably benign	Het
Kdm2b	A	T	5: 122,883,365	M50K	probably damaging	Het
Klk1b1	A	G	7: 43,970,623	D170G	possibly damaging	Het
Lama3	A	T	18: 12,528,726	T2160S	probably benign	Het
Lman1	A	T	18: 65,998,352		probably benign	Het
Lmtk3	G	A	7: 45,800,911		probably null	Het
Ltb	A	G	17: 35,195,763	R180G	probably damaging	Het
Ltbp4	C	T	7: 27,308,953	R1310Q	probably damaging	Het
Macf1	T	A	4: 123,499,919		probably null	Het
Mast4	G	T	13: 102,738,846	P1146Q	probably damaging	Het
Micall2	C	T	5: 139,711,562	S678N	probably damaging	Het
Mon2	A	T	10: 122,995,776	I1675N	probably damaging	Het
Mug2	A	G	6: 122,079,612	N1172S	probably benign	Het
Naa30	C	G	14: 49,173,099	S161R	possibly damaging	Het
Ncaph	T	C	2: 127,124,875	N220D	probably damaging	Het
Nell1	T	C	7: 50,560,830	V497A	possibly damaging	Het
Ngly1	A	G	14: 16,277,877	N142S	possibly damaging	Het
Nin	T	A	12: 70,042,418	T1408S	possibly damaging	Het
Nlrp4g	T	A	9: 124,349,693		noncoding transcript	Het
Nrg1	T	G	8: 31,918,015	E63D	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1167	T	C	2: 88,149,143	Y292C	probably damaging	Het
Olfr128	A	G	17: 37,923,880	T105A	probably benign	Het
Olfr473	C	T	7: 107,933,661	T47M	probably benign	Het
Olfr522	T	A	7: 140,162,824	E42V	probably damaging	Het
Olfr845	A	G	9: 19,339,056	I199V	probably benign	Het
Olfr851	T	A	9: 19,497,237	V163E	possibly damaging	Het
Olfr867	A	T	9: 20,054,596	I289N	probably damaging	Het
Olfr998	G	A	2: 85,591,283	V248I	possibly damaging	Het
Orc5	C	T	5: 22,516,703		probably null	Het
Pard3	G	A	8: 127,398,604	R691Q	probably benign	Het
Pofut1	T	A	2: 153,243,660	D54E	probably benign	Het
Prl2c5	T	A	13: 13,190,653	V128E	probably damaging	Het
Ptk7	T	C	17: 46,566,238	M965V	possibly damaging	Het
Pum2	C	T	12: 8,728,726	R459*	probably null	Het
Pzp	A	T	6: 128,483,710	N1494K	probably benign	Het
Rad21l	A	G	2: 151,645,429	V545A	probably benign	Het
Rps6kc1	A	T	1: 190,810,108	M352K	possibly damaging	Het
Rpusd2	G	A	2: 119,037,215		probably null	Het
Rsph14	A	T	10: 75,029,771	D78E	probably damaging	Het
Rtl9	A	T	X: 143,102,030	M813L	possibly damaging	Het
Rtp4	A	T	16: 23,612,940	H74L	probably damaging	Het
Rusc1	G	A	3: 89,087,848	T725I	possibly damaging	Het
Ryr2	C	T	13: 11,595,736	C4068Y	probably damaging	Het
Ryr3	A	G	2: 112,954,364	V224A	possibly damaging	Het
Shprh	A	T	10: 11,152,120	N157I	probably benign	Het
Siglece	A	G	7: 43,657,786	I67T	probably benign	Het
Slc9b2	A	T	3: 135,326,266	T296S	probably damaging	Het
Sorbs2	A	G	8: 45,775,629	K276E	probably damaging	Het
Synj2	A	G	17: 6,037,480	T1269A	probably benign	Het
Taar7b	T	C	10: 24,000,675	I246T	possibly damaging	Het
Taldo1	A	G	7: 141,396,154	Y113C	probably damaging	Het
Tarbp1	A	T	8: 126,447,594		probably null	Het
Tars	C	T	15: 11,394,373	M59I	probably benign	Het
Tas2r130	G	A	6: 131,630,817	T5I	probably benign	Het
Tex48	T	C	4: 63,607,415	E77G	probably damaging	Het
Tmco5	A	G	2: 116,892,255	R286G	probably damaging	Het
Trdmt1	A	T	2: 13,519,914	H243Q	probably benign	Het
Ttn	T	A	2: 76,734,294	R26754*	probably null	Het
Ttn	G	A	2: 76,897,580		probably benign	Het
Ubqln3	A	C	7: 104,142,151	L244R	probably damaging	Het
Ubxn1	C	T	19: 8,873,566	R115*	probably null	Het
Umod	T	G	7: 119,476,715	N276T	probably damaging	Het
Unc13c	A	T	9: 73,665,656	L1528Q	probably damaging	Het
Unc80	T	A	1: 66,640,595	H2108Q	possibly damaging	Het
Utp20	A	C	10: 88,774,795	D1442E	probably damaging	Het
Utp4	A	G	8: 106,898,521	Q144R	probably benign	Het
Vmn2r17	T	A	5: 109,427,209	N127K	probably benign	Het
Vmn2r75	T	A	7: 86,165,164	T374S	probably benign	Het
Washc5	A	G	15: 59,350,408	F523L	probably damaging	Het
Wdr3	A	T	3: 100,159,897		probably null	Het
Wdr89	T	C	12: 75,632,988	Y164C	probably damaging	Het
Xpo5	T	C	17: 46,225,091	S550P	probably damaging	Het
Zfp69	T	C	4: 120,930,832	T429A	probably damaging	Het
Zfpm1	G	T	8: 122,336,592	G797C	probably benign	Het

Other mutations in Bod1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Bod1l	APN	5	41816823	missense	probably benign	0.00
IGL00990:Bod1l	APN	5	41828865	missense	probably benign	0.00
IGL01021:Bod1l	APN	5	41838173	splice site	probably benign
IGL01022:Bod1l	APN	5	41794309	missense	probably damaging	1.00
IGL01303:Bod1l	APN	5	41817599	missense	probably benign	0.00
IGL01654:Bod1l	APN	5	41818176	missense	probably damaging	0.99
IGL01748:Bod1l	APN	5	41816961	missense	probably benign	0.23
IGL01758:Bod1l	APN	5	41826610	splice site	probably benign
IGL01783:Bod1l	APN	5	41808712	missense	probably benign	0.02
IGL01790:Bod1l	APN	5	41832250	missense	probably benign	0.14
IGL01803:Bod1l	APN	5	41817389	missense	probably damaging	0.97
IGL01829:Bod1l	APN	5	41820468	missense	probably benign	0.25
IGL01952:Bod1l	APN	5	41816954	missense	possibly damaging	0.70
IGL02005:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02110:Bod1l	APN	5	41816453	missense	probably damaging	0.97
IGL02129:Bod1l	APN	5	41821850	missense	probably benign	0.36
IGL02572:Bod1l	APN	5	41821230	nonsense	probably null
IGL02583:Bod1l	APN	5	41816207	critical splice donor site	probably null
IGL02643:Bod1l	APN	5	41818805	missense	possibly damaging	0.65
IGL02714:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02728:Bod1l	APN	5	41826503	missense	probably damaging	1.00
IGL02752:Bod1l	APN	5	41816463	missense	possibly damaging	0.58
IGL02822:Bod1l	APN	5	41794345	missense	possibly damaging	0.94
IGL03032:Bod1l	APN	5	41831584	missense	probably benign	0.16
IGL03372:Bod1l	APN	5	41805235	splice site	probably benign
capacitance	UTSW	5	41791813	missense	possibly damaging	0.91
gauss	UTSW	5	41816867	missense	probably benign	0.01
Tesla	UTSW	5	41795068	critical splice donor site	probably null
R0102:Bod1l	UTSW	5	41817269	missense	probably benign	0.36
R0147:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0148:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0490:Bod1l	UTSW	5	41821892	missense	probably damaging	0.96
R0577:Bod1l	UTSW	5	41794887	missense	probably damaging	1.00
R0587:Bod1l	UTSW	5	41821637	missense	probably benign	0.16
R0620:Bod1l	UTSW	5	41801233	missense	probably benign	0.16
R0626:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R0785:Bod1l	UTSW	5	41820016	missense	probably benign	0.00
R1139:Bod1l	UTSW	5	41831471	missense	possibly damaging	0.64
R1165:Bod1l	UTSW	5	41821053	missense	probably benign	0.02
R1418:Bod1l	UTSW	5	41819471	missense	probably damaging	1.00
R1509:Bod1l	UTSW	5	41819540	missense	probably damaging	0.99
R1533:Bod1l	UTSW	5	41822155	nonsense	probably null
R1538:Bod1l	UTSW	5	41816429	missense	probably benign	0.00
R1591:Bod1l	UTSW	5	41819220	missense	probably benign	0.06
R1616:Bod1l	UTSW	5	41808715	missense	probably benign
R1628:Bod1l	UTSW	5	41816982	missense	probably benign	0.01
R1667:Bod1l	UTSW	5	41816775	missense	probably benign	0.01
R1869:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1870:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1993:Bod1l	UTSW	5	41817336	missense	probably damaging	1.00
R2066:Bod1l	UTSW	5	41805156	missense	probably damaging	0.99
R2067:Bod1l	UTSW	5	41817086	missense	probably benign	0.11
R2073:Bod1l	UTSW	5	41819189	missense	probably benign	0.19
R2092:Bod1l	UTSW	5	41831517	missense	probably damaging	1.00
R2105:Bod1l	UTSW	5	41832279	missense	probably benign	0.00
R2243:Bod1l	UTSW	5	41821545	missense	possibly damaging	0.58
R2322:Bod1l	UTSW	5	41827120	missense	probably benign	0.09
R2849:Bod1l	UTSW	5	41838076	missense	probably damaging	1.00
R2883:Bod1l	UTSW	5	41832259	missense	probably benign	0.03
R3037:Bod1l	UTSW	5	41822037	missense	probably damaging	0.99
R3910:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3911:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3962:Bod1l	UTSW	5	41808721	missense	probably benign	0.07
R4235:Bod1l	UTSW	5	41821455	missense	probably damaging	1.00
R4308:Bod1l	UTSW	5	41791813	missense	possibly damaging	0.91
R4414:Bod1l	UTSW	5	41820527	missense	probably benign	0.04
R4535:Bod1l	UTSW	5	41832231	missense	probably benign	0.06
R4631:Bod1l	UTSW	5	41817735	missense	probably damaging	1.00
R4657:Bod1l	UTSW	5	41818612	missense	probably benign	0.00
R4782:Bod1l	UTSW	5	41833663	missense	probably benign	0.06
R4786:Bod1l	UTSW	5	41819438	missense	probably benign	0.43
R4840:Bod1l	UTSW	5	41818472	missense	probably damaging	1.00
R4877:Bod1l	UTSW	5	41819994	missense	probably benign	0.00
R4982:Bod1l	UTSW	5	41820473	missense	probably benign	0.00
R5152:Bod1l	UTSW	5	41816543	missense	probably benign	0.04
R5284:Bod1l	UTSW	5	41820467	missense	probably benign	0.05
R5354:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R5369:Bod1l	UTSW	5	41827183	missense	probably damaging	1.00
R5486:Bod1l	UTSW	5	41807181	missense	possibly damaging	0.56
R5541:Bod1l	UTSW	5	41791933	missense	probably benign	0.06
R5610:Bod1l	UTSW	5	41821874	missense	probably damaging	1.00
R5655:Bod1l	UTSW	5	41817044	missense	probably benign	0.06
R5705:Bod1l	UTSW	5	41817002	missense	probably benign	0.01
R5819:Bod1l	UTSW	5	41832605	missense	probably benign	0.27
R5890:Bod1l	UTSW	5	41820578	missense	probably benign	0.43
R5923:Bod1l	UTSW	5	41817419	missense	probably damaging	1.00
R5991:Bod1l	UTSW	5	41816863	nonsense	probably null
R6017:Bod1l	UTSW	5	41818760	missense	probably benign	0.01
R6253:Bod1l	UTSW	5	41826538	missense	probably damaging	0.96
R6284:Bod1l	UTSW	5	41818787	missense	probably benign	0.35
R6483:Bod1l	UTSW	5	41821082	missense	probably benign	0.03
R6485:Bod1l	UTSW	5	41817116	missense	possibly damaging	0.93
R6575:Bod1l	UTSW	5	41838068	missense	probably damaging	1.00
R6679:Bod1l	UTSW	5	41816666	missense	probably damaging	0.97
R6788:Bod1l	UTSW	5	41821873	nonsense	probably null
R7006:Bod1l	UTSW	5	41832552	missense	probably damaging	1.00
R7095:Bod1l	UTSW	5	41795068	critical splice donor site	probably null
R7111:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7190:Bod1l	UTSW	5	41819938	missense	probably benign	0.14
R7311:Bod1l	UTSW	5	41794333	missense	possibly damaging	0.57
R7336:Bod1l	UTSW	5	41821524	missense	probably damaging	1.00
R7341:Bod1l	UTSW	5	41788857	missense	probably benign	0.00
R7396:Bod1l	UTSW	5	41831546	missense	probably damaging	1.00
R7431:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7442:Bod1l	UTSW	5	41807179	missense	probably damaging	0.96
R7539:Bod1l	UTSW	5	41817860	missense	possibly damaging	0.65
R7583:Bod1l	UTSW	5	41833790	missense	probably damaging	1.00
R7679:Bod1l	UTSW	5	41820643	frame shift	probably null
R7748:Bod1l	UTSW	5	41832340	missense	probably damaging	0.97
R7767:Bod1l	UTSW	5	41816756	missense	probably benign	0.01
R7773:Bod1l	UTSW	5	41832712	missense	probably benign	0.14
R7782:Bod1l	UTSW	5	41817943	missense	probably benign	0.01
R7860:Bod1l	UTSW	5	41819265	missense	probably damaging	1.00
R7975:Bod1l	UTSW	5	41816277	missense	possibly damaging	0.90
R7977:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R7987:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R8104:Bod1l	UTSW	5	41833732	nonsense	probably null
R8217:Bod1l	UTSW	5	41831507	missense	probably damaging	1.00
R8307:Bod1l	UTSW	5	41821155	missense	probably damaging	1.00
R8469:Bod1l	UTSW	5	41821491	missense	possibly damaging	0.86
R8506:Bod1l	UTSW	5	41819055	nonsense	probably null
R8934:Bod1l	UTSW	5	41819601	missense	probably benign	0.11
R8984:Bod1l	UTSW	5	41788872	missense	probably damaging	1.00
R8989:Bod1l	UTSW	5	41821682	missense	probably benign	0.00
R8993:Bod1l	UTSW	5	41816867	missense	probably benign	0.01
R9128:Bod1l	UTSW	5	41788923	missense	probably benign	0.22
R9129:Bod1l	UTSW	5	41818877	missense	probably damaging	0.99
R9198:Bod1l	UTSW	5	41799786	missense	probably benign	0.08
R9254:Bod1l	UTSW	5	41821880	missense	probably damaging	1.00
R9445:Bod1l	UTSW	5	41817276	missense	probably benign	0.04
R9457:Bod1l	UTSW	5	41821967	missense	probably damaging	0.99
R9470:Bod1l	UTSW	5	41817096	missense	probably damaging	0.99
R9536:Bod1l	UTSW	5	41816962	missense	probably benign	0.01
R9654:Bod1l	UTSW	5	41818364	missense	probably benign	0.02
R9734:Bod1l	UTSW	5	41805230	missense	possibly damaging	0.91
R9771:Bod1l	UTSW	5	41791863	missense	probably damaging	0.96
X0027:Bod1l	UTSW	5	41832669	missense	probably benign	0.20
X0058:Bod1l	UTSW	5	41824018	missense	probably damaging	1.00
Z1088:Bod1l	UTSW	5	41808764	missense	possibly damaging	0.95
Z1088:Bod1l	UTSW	5	41821146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGCTGCTGGCAAAGTTG -3'
(R):5'- TTTTCACAAAGCAGGCCCTCTG -3'

Sequencing Primer
(F):5'- GCAATGCTTAATGTTCACTTGATTGG -3'
(R):5'- AAAGCAGGCCCTCTGTATCCTTG -3'

Posted On

2014-09-17